Imprinted Gene Databases

Homo sapiens: IGF2R

Insulin-like growth factor 2 receptor

Killian et al. Hum Mol Genet 10: 1721-1728, 2001

Species Gene Aliases Location Status Expressed Allele
Monodelphis domestica IGF2R     Imprinted Maternal
Macaca mulatta IGF2R   Conflicting Data Biallelic
Osteichthyes IGF2R     Not Imprinted Biallelic
Sus scrofa IGF2R M6P/IGF2R  Not Imprinted Biallelic
Rattus norvegicus Igf2r   1q11  Imprinted Maternal
Homo sapiens IGF2R MPR1, MPRI, CD222, CIMPR, M6P-R  6q26  Conflicting Data Biallelic
Tachyglossus aculeatus IGF2R     Not Imprinted Biallelic
Mus musculus Igf2r CD222, CI-MPR, Mpr300, AI661837, M6P/IGF2R  17 7.35 cM  Imprinted Maternal
Bos taurus IGF2R CIMPR, CI-MPR  9q27-q28  Imprinted Maternal
Ornithorhynchus anatinus IGF2R     Not Imprinted Biallelic
Ovis aries IGF2R IGF-IIR, IGF2R    Imprinted Maternal
Canis lupus familiaris IGF2R IGF2R  Imprinted Maternal
Gallus gallus domesticus IGF2R   Not Imprinted Biallelic
Didelphis virginiana IGF2R     Imprinted Maternal
1      cgagcccagtcgagccgcgctcacctcgggctcccgctccgtctccacctccgcctttgc     60
       ............................................................
61     cctggcggcgcgaccccgtcccgggcgcggcccccagcagtcgcgcgccgttagcctcgc    120
       ............................................................
121    gcccgccgcgcagtccgggcccggcgcgATGGGGGCCGCCGCCGGCCGGAGCCCCCACCT    180
       ............................M--G--A--A--A--G--R--S--P--H--L-
181    GGGGCCCGCGCCCGCCCGCCGCCCGCAGCGCTCTCTGCTCCTGCTGCAGCTGCTGCTGCT    240
       -G--P--A--P--A--R--R--P--Q--R--S--L--L--L--L--Q--L--L--L--L-
241    CGTCGCTGCCCCGGGGTCCACGCAGGCCCAGGCCGCCCCGTTCCCCGAGCTGTGCAGTTA    300
       -V--A--A--P--G--S--T--Q--A--Q--A--A--P--F--P--E--L--C--S--Y-
301    TACATGGGAAGCTGTTGATACCAAAAATAATGTACTTTATAAAATCAACATCTGTGGAAG    360
       -T--W--E--A--V--D--T--K--N--N--V--L--Y--K--I--N--I--C--G--S-
361    TGTGGATATTGTCCAGTGCGGGCCATCAAGTGCTGTTTGTATGCACGACTTGAAGACACG    420
       -V--D--I--V--Q--C--G--P--S--S--A--V--C--M--H--D--L--K--T--R-
421    CACTTATCATTCAGTGGGTGACTCTGTTTTGAGAAGTGCAACCAGATCTCTCCTGGAATT    480
       -T--Y--H--S--V--G--D--S--V--L--R--S--A--T--R--S--L--L--E--F-
481    CAACACAACAGTGAGCTGTGACCAGCAAGGCACAAATCACAGAGTCCAGAGCAGCATTGC    540
       -N--T--T--V--S--C--D--Q--Q--G--T--N--H--R--V--Q--S--S--I--A-
541    CTTCCTGTGTGGGAAAACCCTGGGAACTCCTGAATTTGTAACTGCAACAGAATGTGTGCA    600
       -F--L--C--G--K--T--L--G--T--P--E--F--V--T--A--T--E--C--V--H-
601    CTACTTTGAGTGGAGGACCACTGCAGCCTGCAAGAAAGACATATTTAAAGCAAATAAGGA    660
       -Y--F--E--W--R--T--T--A--A--C--K--K--D--I--F--K--A--N--K--E-
661    GGTGCCATGCTATGTGTTTGATGAAGAGTTGAGGAAGCATGATCTCAATCCTCTGATCAA    720
       -V--P--C--Y--V--F--D--E--E--L--R--K--H--D--L--N--P--L--I--K-
721    GCTTAGTGGTGCCTACTTGGTGGATGACTCCGATCCGGACACTTCTCTATTCATCAATGT    780
       -L--S--G--A--Y--L--V--D--D--S--D--P--D--T--S--L--F--I--N--V-
781    TTGTAGAGACATAGACACACTACGAGACCCAGGTTCACAGCTGCGGGCCTGTCCCCCCGG    840
       -C--R--D--I--D--T--L--R--D--P--G--S--Q--L--R--A--C--P--P--G-
841    CACTGCCGCCTGCCTGGTAAGAGGACACCAGGCGTTTGATGTTGGCCAGCCCCGGGACGG    900
       -T--A--A--C--L--V--R--G--H--Q--A--F--D--V--G--Q--P--R--D--G-
901    ACTGAAGCTGGTGCGCAAGGACAGGCTTGTCCTGAGTTACGTGAGGGAAGAGGCAGGAAA    960
       -L--K--L--V--R--K--D--R--L--V--L--S--Y--V--R--E--E--A--G--K-
961    GCTAGACTTTTGTGATGGTCACAGCCCTGCGGTGACTATTACATTTGTTTGCCCGTCGGA   1020
       -L--D--F--C--D--G--H--S--P--A--V--T--I--T--F--V--C--P--S--E-
1021   GCGGAGAGAGGGCACCATTCCCAAACTCACAGCTAAATCCAACTGCCGCTATGAAATTGA   1080
       -R--R--E--G--T--I--P--K--L--T--A--K--S--N--C--R--Y--E--I--E-
1081   GTGGATTACTGAGTATGCCTGCCACAGAGATTACCTGGAAAGTAAAACTTGTTCTCTGAG   1140
       -W--I--T--E--Y--A--C--H--R--D--Y--L--E--S--K--T--C--S--L--S-
1141   CGGCGAGCAGCAGGATGTCTCCATAGACCTCACACCACTTGCCCAGAGCGGAGGTTCATC   1200
       -G--E--Q--Q--D--V--S--I--D--L--T--P--L--A--Q--S--G--G--S--S-
1201   CTATATTTCAGATGGAAAAGAATATTTGTTTTATTTGAATGTCTGTGGAGAAACTGAAAT   1260
       -Y--I--S--D--G--K--E--Y--L--F--Y--L--N--V--C--G--E--T--E--I-
1261   ACAGTTCTGTAATAAAAAACAAGCTGCAGTTTGCCAAGTGAAAAAGAGCGATACCTCTCA   1320
       -Q--F--C--N--K--K--Q--A--A--V--C--Q--V--K--K--S--D--T--S--Q-
1321   AGTCAAAGCAGCAGGAAGATACCACAATCAGACCCTCCGATATTCGGATGGAGACCTCAC   1380
       -V--K--A--A--G--R--Y--H--N--Q--T--L--R--Y--S--D--G--D--L--T-
1381   CTTGATATATTTTGGAGGTGATGAATGCAGCTCAGGGTTTCAGCGGATGAGCGTCATAAA   1440
       -L--I--Y--F--G--G--D--E--C--S--S--G--F--Q--R--M--S--V--I--N-
1441   CTTTGAGTGCAATAAAACCGCAGGTAACGATGGGAAAGGAACTCCTGTATTCACAGGGGA   1500
       -F--E--C--N--K--T--A--G--N--D--G--K--G--T--P--V--F--T--G--E-
1501   GGTTGACTGCACCTACTTCTTCACATGGGACACGGAATACGCCTGTGTTAAGGAGAAGGA   1560
       -V--D--C--T--Y--F--F--T--W--D--T--E--Y--A--C--V--K--E--K--E-
1561   AGACCTCCTCTGCGGTGCCACCGACGGGAAGAAGCGCTATGACCTGTCCGCGCTGGTCCG   1620
       -D--L--L--C--G--A--T--D--G--K--K--R--Y--D--L--S--A--L--V--R-
1621   CCATGCAGAACCAGAGCAGAATTGGGAAGCTGTGGATGGCAGTCAGACGGAAACAGAGAA   1680
       -H--A--E--P--E--Q--N--W--E--A--V--D--G--S--Q--T--E--T--E--K-
1681   GAAGCATTTTTTCATTAATATTTGTCACAGAGTGCTGCAGGAAGGCAAGGCACGAGGGTG   1740
       -K--H--F--F--I--N--I--C--H--R--V--L--Q--E--G--K--A--R--G--C-
1741   TCCCGAGGACGCGGCAGTGTGTGCAGTGGATAAAAATGGAAGTAAAAATCTGGGAAAATT   1800
       -P--E--D--A--A--V--C--A--V--D--K--N--G--S--K--N--L--G--K--F-
1801   TATTTCCTCTCCCATGAAAGAGAAAGGAAACATTCAACTCTCTTATTCAGATGGTGATGA   1860
       -I--S--S--P--M--K--E--K--G--N--I--Q--L--S--Y--S--D--G--D--D-
1861   TTGTGGTCATGGCAAGAAAATTAAAACTAATATCACACTTGTATGCAAGCCAGGTGATCT   1920
       -C--G--H--G--K--K--I--K--T--N--I--T--L--V--C--K--P--G--D--L-
1921   GGAAAGTGCACCAGTGTTGAGAACTTCTGGGGAAGGCGGTTGCTTTTATGAGTTTGAGTG   1980
       -E--S--A--P--V--L--R--T--S--G--E--G--G--C--F--Y--E--F--E--W-
1981   GCACACAGCTGCGGCCTGTGTGCTGTCTAAGACAGAAGGGGAGAACTGCACGGTCTTTGA   2040
       -H--T--A--A--A--C--V--L--S--K--T--E--G--E--N--C--T--V--F--D-
2041   CTCCCAGGCAGGGTTTTCTTTTGACTTATCACCTCTCACAAAGAAAAATGGTGCCTATAA   2100
       -S--Q--A--G--F--S--F--D--L--S--P--L--T--K--K--N--G--A--Y--K-
2101   AGTTGAGACAAAGAAGTATGACTTTTATATAAATGTGTGTGGCCCGGTGTCTGTGAGCCC   2160
       -V--E--T--K--K--Y--D--F--Y--I--N--V--C--G--P--V--S--V--S--P-
2161   CTGTCAGCCAGACTCAGGAGCCTGCCAGGTGGCAAAAAGTGATGAGAAGACTTGGAACTT   2220
       -C--Q--P--D--S--G--A--C--Q--V--A--K--S--D--E--K--T--W--N--L-
2221   GGGTCTGAGTAATGCGAAGCTTTCATATTATGATGGGATGATCCAACTGAACTACAGAGG   2280
       -G--L--S--N--A--K--L--S--Y--Y--D--G--M--I--Q--L--N--Y--R--G-
2281   CGGCACACCCTATAACAATGAAAGACACACACCGAGAGCTACGCTCATCACCTTTCTCTG   2340
       -G--T--P--Y--N--N--E--R--H--T--P--R--A--T--L--I--T--F--L--C-
2341   TGATCGAGACGCGGGAGTGGGCTTCCCTGAATATCAGGAAGAGGATAACTCCACCTACAA   2400
       -D--R--D--A--G--V--G--F--P--E--Y--Q--E--E--D--N--S--T--Y--N-
2401   CTTCCGGTGGTACACCAGCTATGCCTGCCCGGAGGAGCCCCTGGAATGCGTAGTGACCGA   2460
       -F--R--W--Y--T--S--Y--A--C--P--E--E--P--L--E--C--V--V--T--D-
2461   CCCCTCCACGCTGGAGCAGTACGACCTCTCCAGTCTGGCAAAATCTGAAGGTGGCCTTGG   2520
       -P--S--T--L--E--Q--Y--D--L--S--S--L--A--K--S--E--G--G--L--G-
2521   AGGAAACTGGTATGCCATGGACAACTCAGGGGAACATGTCACGTGGAGGAAATACTACAT   2580
       -G--N--W--Y--A--M--D--N--S--G--E--H--V--T--W--R--K--Y--Y--I-
2581   TAACGTGTGTCGGCCTCTGAATCCAGTGCCGGGCTGCAACCGATATGCATCGGCTTGCCA   2640
       -N--V--C--R--P--L--N--P--V--P--G--C--N--R--Y--A--S--A--C--Q-
2641   GATGAAGTATGAAAAAGATCAGGGCTCCTTCACTGAAGTGGTTTCCATCAGTAACTTGGG   2700
       -M--K--Y--E--K--D--Q--G--S--F--T--E--V--V--S--I--S--N--L--G-
2701   AATGGCAAAGACCGGCCCGGTGGTTGAGGACAGCGGCAGCCTCCTTCTGGAATACGTGAA   2760
       -M--A--K--T--G--P--V--V--E--D--S--G--S--L--L--L--E--Y--V--N-
2761   TGGGTCGGCCTGCACCACCAGCGATGGCAGACAGACCACATATACCACGAGGATCCATCT   2820
       -G--S--A--C--T--T--S--D--G--R--Q--T--T--Y--T--T--R--I--H--L-
2821   CGTCTGCTCCAGGGGCAGGCTGAACAGCCACCCCATCTTTTCTCTCAACTGGGAGTGTGT   2880
       -V--C--S--R--G--R--L--N--S--H--P--I--F--S--L--N--W--E--C--V-
2881   GGTCAGTTTCCTGTGGAACACAGAGGCTGCCTGTCCCATTCAGACAACGACGGATACAGA   2940
       -V--S--F--L--W--N--T--E--A--A--C--P--I--Q--T--T--T--D--T--D-
2941   CCAGGCTTGCTCTATAAGGGATCCCAACAGTGGATTTGTGTTTAATCTTAATCCGCTAAA   3000
       -Q--A--C--S--I--R--D--P--N--S--G--F--V--F--N--L--N--P--L--N-
3001   CAGTTCGCAAGGATATAACGTCTCTGGCATTGGGAAGATTTTTATGTTTAATGTCTGCGG   3060
       -S--S--Q--G--Y--N--V--S--G--I--G--K--I--F--M--F--N--V--C--G-
3061   CACAATGCCTGTCTGTGGGACCATCCTGGGAAAACCTGCTTCTGGCTGTGAGGCAGAAAC   3120
       -T--M--P--V--C--G--T--I--L--G--K--P--A--S--G--C--E--A--E--T-
3121   CCAAACTGAAGAGCTCAAGAATTGGAAGCCAGCAAGGCCAGTCGGAATTGAGAAAAGCCT   3180
       -Q--T--E--E--L--K--N--W--K--P--A--R--P--V--G--I--E--K--S--L-
3181   CCAGCTGTCCACAGAGGGCTTCATCACTCTGACCTACAAAGGGCCTCTCTCTGCCAAAGG   3240
       -Q--L--S--T--E--G--F--I--T--L--T--Y--K--G--P--L--S--A--K--G-
3241   TACCGCTGATGCTTTTATCGTCCGCTTTGTTTGCAATGATGATGTTTACTCAGGGCCCCT   3300
       -T--A--D--A--F--I--V--R--F--V--C--N--D--D--V--Y--S--G--P--L-
3301   CAAATTCCTGCATCAAGATATCGACTCTGGGCAAGGGATCCGAAACACTTACTTTGAGTT   3360
       -K--F--L--H--Q--D--I--D--S--G--Q--G--I--R--N--T--Y--F--E--F-
3361   TGAAACCGCGTTGGCCTGTGTTCCTTCTCCAGTGGACTGCCAAGTCACCGACCTGGCTGG   3420
       -E--T--A--L--A--C--V--P--S--P--V--D--C--Q--V--T--D--L--A--G-
3421   AAATGAGTACGACCTGACTGGCCTAAGCACAGTCAGGAAACCTTGGACGGCTGTTGACAC   3480
       -N--E--Y--D--L--T--G--L--S--T--V--R--K--P--W--T--A--V--D--T-
3481   CTCTGTCGATGGGAGAAAGAGGACTTTCTATTTGAGCGTTTGCAATCCTCTCCCTTACAT   3540
       -S--V--D--G--R--K--R--T--F--Y--L--S--V--C--N--P--L--P--Y--I-
3541   TCCTGGATGCCAGGGCAGCGCAGTGGGGTCTTGCTTAGTGTCAGAAGGCAATAGCTGGAA   3600
       -P--G--C--Q--G--S--A--V--G--S--C--L--V--S--E--G--N--S--W--N-
3601   TCTGGGTGTGGTGCAGATGAGTCCCCAAGCCGCGGCGAATGGATCTTTGAGCATCATGTA   3660
       -L--G--V--V--Q--M--S--P--Q--A--A--A--N--G--S--L--S--I--M--Y-
3661   TGTCAACGGTGACAAGTGTGGGAACCAGCGCTTCTCCACCAGGATCACGTTTGAGTGTGC   3720
       -V--N--G--D--K--C--G--N--Q--R--F--S--T--R--I--T--F--E--C--A-
3721   TCAGATATCGGGCTCACCAGCATTTCAGCTTCAGGATGGTTGTGAGTACGTGTTTATCTG   3780
       -Q--I--S--G--S--P--A--F--Q--L--Q--D--G--C--E--Y--V--F--I--W-
3781   GAGAACTGTGGAAGCCTGTCCCGTTGTCAGAGTGGAAGGGGACAACTGTGAGGTGAAAGA   3840
       -R--T--V--E--A--C--P--V--V--R--V--E--G--D--N--C--E--V--K--D-
3841   CCCAAGGCATGGCAACTTGTATGACCTGAAGCCCCTGGGCCTCAACGACACCATCGTGAG   3900
       -P--R--H--G--N--L--Y--D--L--K--P--L--G--L--N--D--T--I--V--S-
3901   CGCTGGCGAATACACTTATTACTTCCGGGTCTGTGGGAAGCTTTCCTCAGACGTCTGCCC   3960
       -A--G--E--Y--T--Y--Y--F--R--V--C--G--K--L--S--S--D--V--C--P-
3961   CACAAGTGACAAGTCCAAGGTGGTCTCCTCATGTCAGGAAAAGCGGGAACCGCAGGGATT   4020
       -T--S--D--K--S--K--V--V--S--S--C--Q--E--K--R--E--P--Q--G--F-
4021   TCACAAAGTGGCAGGTCTCCTGACTCAGAAGCTAACTTATGAAAATGGCTTGTTAAAAAT   4080
       -H--K--V--A--G--L--L--T--Q--K--L--T--Y--E--N--G--L--L--K--M-
4081   GAACTTCACGGGGGGGGACACTTGCCATAAGGTTTATCAGCGCTCCACAGCCATCTTCTT   4140
       -N--F--T--G--G--D--T--C--H--K--V--Y--Q--R--S--T--A--I--F--F-
4141   CTACTGTGACCGCGGCACCCAGCGGCCAGTATTTCTAAAGGAGACTTCAGATTGTTCCTA   4200
       -Y--C--D--R--G--T--Q--R--P--V--F--L--K--E--T--S--D--C--S--Y-
4201   CTTGTTTGAGTGGCGAACGCAGTATGCCTGCCCACCTTTCGATCTGACTGAATGTTCATT   4260
       -L--F--E--W--R--T--Q--Y--A--C--P--P--F--D--L--T--E--C--S--F-
4261   CAAAGATGGGGCTGGCAACTCCTTCGACCTCTCGTCCCTGTCAAGGTACAGTGACAACTG   4320
       -K--D--G--A--G--N--S--F--D--L--S--S--L--S--R--Y--S--D--N--W-
4321   GGAAGCCATCACTGGGACGGGGGACCCGGAGCACTACCTCATCAATGTCTGCAAGTCTCT   4380
       -E--A--I--T--G--T--G--D--P--E--H--Y--L--I--N--V--C--K--S--L-
4381   GGCCCCGCAGGCTGGCACTGAGCCGTGCCCTCCAGAAGCAGCCGCGTGTCTGCTGGGTGG   4440
       -A--P--Q--A--G--T--E--P--C--P--P--E--A--A--A--C--L--L--G--G-
4441   CTCCAAGCCCGTGAACCTCGGCAGGGTAAGGGACGGACCTCAGTGGAGAGATGGCATAAT   4500
       -S--K--P--V--N--L--G--R--V--R--D--G--P--Q--W--R--D--G--I--I-
4501   TGTCCTGAAATACGTTGATGGCGACTTATGTCCAGATGGGATTCGGAAAAAGTCAACCAC   4560
       -V--L--K--Y--V--D--G--D--L--C--P--D--G--I--R--K--K--S--T--T-
4561   CATCCGATTCACCTGCAGCGAGAGCCAAGTGAACTCCAGGCCCATGTTCATCAGCGCCGT   4620
       -I--R--F--T--C--S--E--S--Q--V--N--S--R--P--M--F--I--S--A--V-
4621   GGAGGACTGTGAGTACACCTTTGCCTGGCCCACAGCCACAGCCTGTCCCATGAAGAGCAA   4680
       -E--D--C--E--Y--T--F--A--W--P--T--A--T--A--C--P--M--K--S--N-
4681   CGAGCATGATGACTGCCAGGTCACCAACCCAAGCACAGGACACCTGTTTGATCTGAGCTC   4740
       -E--H--D--D--C--Q--V--T--N--P--S--T--G--H--L--F--D--L--S--S-
4741   CTTAAGTGGCAGGGCGGGATTCACAGCTGCTTACAGCGAGAAGGGGTTGGTTTACATGAG   4800
       -L--S--G--R--A--G--F--T--A--A--Y--S--E--K--G--L--V--Y--M--S-
4801   CATCTGTGGGGAGAATGAAAACTGCCCTCCTGGCGTGGGGGCCTGCTTTGGACAGACCAG   4860
       -I--C--G--E--N--E--N--C--P--P--G--V--G--A--C--F--G--Q--T--R-
4861   GATTAGCGTGGGCAAGGCCAACAAGAGGCTGAGATACGTGGACCAGGTCCTGCAGCTGGT   4920
       -I--S--V--G--K--A--N--K--R--L--R--Y--V--D--Q--V--L--Q--L--V-
4921   GTACAAGGATGGGTCCCCTTGTCCCTCCAAATCCGGCCTGAGCTATAAGAGTGTGATCAG   4980
       -Y--K--D--G--S--P--C--P--S--K--S--G--L--S--Y--K--S--V--I--S-
4981   TTTCGTGTGCAGGCCTGAGGCCGGGCCAACCAATAGGCCCATGCTCATCTCCCTGGACAA   5040
       -F--V--C--R--P--E--A--G--P--T--N--R--P--M--L--I--S--L--D--K-
5041   GCAGACATGCACTCTCTTCTTCTCCTGGCACACGCCGCTGGCCTGCGAGCAAGCGACCGA   5100
       -Q--T--C--T--L--F--F--S--W--H--T--P--L--A--C--E--Q--A--T--E-
5101   ATGTTCCGTGAGGAATGGAAGCTCTATTGTTGACTTGTCTCCCCTTATTCATCGCACTGG   5160
       -C--S--V--R--N--G--S--S--I--V--D--L--S--P--L--I--H--R--T--G-
5161   TGGTTATGAGGCTTATGATGAGAGTGAGGATGATGCCTCCGATACCAACCCTGATTTCTA   5220
       -G--Y--E--A--Y--D--E--S--E--D--D--A--S--D--T--N--P--D--F--Y-
5221   CATCAATATTTGTCAGCCACTAAATCCCATGCACGGAGTGCCCTGTCCTGCCGGAGCCGC   5280
       -I--N--I--C--Q--P--L--N--P--M--H--G--V--P--C--P--A--G--A--A-
5281   TGTGTGCAAAGTTCCTATTGATGGTCCCCCCATAGATATCGGCCGGGTAGCAGGACCACC   5340
       -V--C--K--V--P--I--D--G--P--P--I--D--I--G--R--V--A--G--P--P-
5341   AATACTCAATCCAATAGCAAATGAGATTTACTTGAATTTTGAAAGCAGTACTCCTTGCTT   5400
       -I--L--N--P--I--A--N--E--I--Y--L--N--F--E--S--S--T--P--C--L-
5401   AGCGGACAAGCATTTCAACTACACCTCGCTCATCGCGTTTCACTGTAAGAGAGGTGTGAG   5460
       -A--D--K--H--F--N--Y--T--S--L--I--A--F--H--C--K--R--G--V--S-
5461   CATGGGAACGCCTAAGCTGTTAAGGACCAGCGAGTGCGACTTTGTGTTCGAATGGGAGAC   5520
       -M--G--T--P--K--L--L--R--T--S--E--C--D--F--V--F--E--W--E--T-
5521   TCCTGTCGTCTGTCCTGATGAAGTGAGGATGGATGGCTGTACCCTGACAGATGAGCAGCT   5580
       -P--V--V--C--P--D--E--V--R--M--D--G--C--T--L--T--D--E--Q--L-
5581   CCTCTACAGCTTCAACTTGTCCAGCCTTTCCACGAGCACCTTTAAGGTGACTCGCGACTC   5640
       -L--Y--S--F--N--L--S--S--L--S--T--S--T--F--K--V--T--R--D--S-
5641   GCGCACCTACAGCGTTGGGGTGTGCACCTTTGCAGTCGGGCCAGAACAAGGAGGCTGTAA   5700
       -R--T--Y--S--V--G--V--C--T--F--A--V--G--P--E--Q--G--G--C--K-
5701   GGACGGAGGAGTCTGTCTGCTCTCAGGCACCAAGGGGGCATCCTTTGGACGGCTGCAATC   5760
       -D--G--G--V--C--L--L--S--G--T--K--G--A--S--F--G--R--L--Q--S-
5761   AATGAAACTGGATTACAGGCACCAGGATGAAGCGGTCGTTTTAAGTTACGTGAATGGTGA   5820
       -M--K--L--D--Y--R--H--Q--D--E--A--V--V--L--S--Y--V--N--G--D-
5821   TCGTTGCCCTCCAGAAACCGATGACGGCGTCCCCTGTGTCTTCCCCTTCATATTCAATGG   5880
       -R--C--P--P--E--T--D--D--G--V--P--C--V--F--P--F--I--F--N--G-
5881   GAAGAGCTACGAGGAGTGCATCATAGAGAGCAGGGCGAAGCTGTGGTGTAGCACAACTGC   5940
       -K--S--Y--E--E--C--I--I--E--S--R--A--K--L--W--C--S--T--T--A-
5941   GGACTACGACAGAGACCACGAGTGGGGCTTCTGCAGACACTCAAACAGCTACCGGACATC   6000
       -D--Y--D--R--D--H--E--W--G--F--C--R--H--S--N--S--Y--R--T--S-
6001   CAGCATCATATTTAAGTGTGATGAAGATGAGGACATTGGGAGGCCACAAGTCTTCAGTGA   6060
       -S--I--I--F--K--C--D--E--D--E--D--I--G--R--P--Q--V--F--S--E-
6061   AGTGCGTGGGTGTGATGTGACATTTGAGTGGAAAACAAAAGTTGTCTGCCCTCCAAAGAA   6120
       -V--R--G--C--D--V--T--F--E--W--K--T--K--V--V--C--P--P--K--K-
6121   GTTGGAGTGCAAATTCGTCCAGAAACACAAAACCTACGACCTGCGGCTGCTCTCCTCTCT   6180
       -L--E--C--K--F--V--Q--K--H--K--T--Y--D--L--R--L--L--S--S--L-
6181   CACCGGGTCCTGGTCCCTGGTCCACAACGGAGTCTCGTACTATATAAATCTGTGCCAGAA   6240
       -T--G--S--W--S--L--V--H--N--G--V--S--Y--Y--I--N--L--C--Q--K-
6241   AATATATAAAGGGCCCCTGGGCTGCTCTGAAAGGGCCAGCATTTGCAGAAGGACCACAAC   6300
       -I--Y--K--G--P--L--G--C--S--E--R--A--S--I--C--R--R--T--T--T-
6301   TGGTGACGTCCAGGTCCTGGGACTCGTTCACACGCAGAAGCTGGGTGTCATAGGTGACAA   6360
       -G--D--V--Q--V--L--G--L--V--H--T--Q--K--L--G--V--I--G--D--K-
6361   AGTTGTTGTCACGTACTCCAAAGGTTATCCGTGTGGTGGAAATAAGACCGCATCCTCCGT   6420
       -V--V--V--T--Y--S--K--G--Y--P--C--G--G--N--K--T--A--S--S--V-
6421   GATAGAATTGACCTGTACAAAGACGGTGGGCAGACCTGCATTCAAGAGGTTTGATATCGA   6480
       -I--E--L--T--C--T--K--T--V--G--R--P--A--F--K--R--F--D--I--D-
6481   CAGCTGCACTTACTACTTCAGCTGGGACTCCCGGGCTGCCTGCGCCGTGAAGCCTCAGGA   6540
       -S--C--T--Y--Y--F--S--W--D--S--R--A--A--C--A--V--K--P--Q--E-
6541   GGTGCAGATGGTGAATGGGACCATCACCAACCCTATAAATGGCAAGAGCTTCAGCCTCGG   6600
       -V--Q--M--V--N--G--T--I--T--N--P--I--N--G--K--S--F--S--L--G-
6601   AGATATTTATTTTAAGCTGTTCAGAGCCTCTGGGGACATGAGGACCAATGGGGACAACTA   6660
       -D--I--Y--F--K--L--F--R--A--S--G--D--M--R--T--N--G--D--N--Y-
6661   CCTGTATGAGATCCAACTTTCCTCCATCACAAGCTCCAGAAACCCGGCGTGCTCTGGAGC   6720
       -L--Y--E--I--Q--L--S--S--I--T--S--S--R--N--P--A--C--S--G--A-
6721   CAACATATGCCAGGTGAAGCCCAACGATCAGCACTTCAGTCGGAAAGTTGGAACCTCTGA   6780
       -N--I--C--Q--V--K--P--N--D--Q--H--F--S--R--K--V--G--T--S--D-
6781   CAAGACCAAGTACTACCTTCAAGACGGCGATCTCGATGTCGTGTTTGCCTCTTCCTCTAA   6840
       -K--T--K--Y--Y--L--Q--D--G--D--L--D--V--V--F--A--S--S--S--K-
6841   GTGCGGAAAGGATAAGACCAAGTCTGTTTCTTCCACCATCTTCTTCCACTGTGACCCTCT   6900
       -C--G--K--D--K--T--K--S--V--S--S--T--I--F--F--H--C--D--P--L-
6901   GGTGGAGGACGGGATCCCCGAGTTCAGTCACGAGACTGCCGACTGCCAGTACCTCTTCTC   6960
       -V--E--D--G--I--P--E--F--S--H--E--T--A--D--C--Q--Y--L--F--S-
6961   TTGGTACACCTCAGCCGTGTGTCCTCTGGGGGTGGGCTTTGACAGCGAGAATCCCGGGGA   7020
       -W--Y--T--S--A--V--C--P--L--G--V--G--F--D--S--E--N--P--G--D-
7021   CGACGGGCAGATGCACAAGGGGCTGTCAGAACGGAGCCAGGCAGTCGGCGCGGTGCTCAG   7080
       -D--G--Q--M--H--K--G--L--S--E--R--S--Q--A--V--G--A--V--L--S-
7081   CCTGCTGCTGGTGGCGCTCACCTGCTGCCTGCTGGCCCTGTTGCTCTACAAGAAGGAGAG   7140
       -L--L--L--V--A--L--T--C--C--L--L--A--L--L--L--Y--K--K--E--R-
7141   GAGGGAAACAGTGATAAGTAAGCTGACCACTTGCTGTAGGAGAAGTTCCAACGTGTCCTA   7200
       -R--E--T--V--I--S--K--L--T--T--C--C--R--R--S--S--N--V--S--Y-
7201   CAAATACTCAAAGGTGAATAAGGAAGAAGAGACAGATGAGAATGAAACAGAGTGGCTGAT   7260
       -K--Y--S--K--V--N--K--E--E--E--T--D--E--N--E--T--E--W--L--M-
7261   GGAAGAGATCCAGCTGCCTCCTCCACGGCAGGGAAAGGAAGGGCAGGAGAACGGCCATAT   7320
       -E--E--I--Q--L--P--P--P--R--Q--G--K--E--G--Q--E--N--G--H--I-
7321   TACCACCAAGTCAGTGAAAGCCCTCAGCTCCCTGCATGGGGATGACCAGGACAGTGAGGA   7380
       -T--T--K--S--V--K--A--L--S--S--L--H--G--D--D--Q--D--S--E--D-
7381   TGAGGTTCTGACCATCCCAGAGGTGAAAGTTCACTCGGGCAGGGGAGCTGGGGCAGAGAG   7440
       -E--V--L--T--I--P--E--V--K--V--H--S--G--R--G--A--G--A--E--S-
7441   CTCCCACCCAGTGAGAAACGCACAGAGCAATGCCCTTCAGGAGCGTGAGGACGATAGGGT   7500
       -S--H--P--V--R--N--A--Q--S--N--A--L--Q--E--R--E--D--D--R--V-
7501   GGGGCTGGTCAGGGGTGAGAAGGCGAGGAAAGGGAAGTCCAGCTCTGCACAGCAGAAGAC   7560
       -G--L--V--R--G--E--K--A--R--K--G--K--S--S--S--A--Q--Q--K--T-
7561   AGTGAGCTCCACCAAGCTGGTGTCCTTCCATGACGACAGCGACGAGGACCTCTTACACAT   7620
       -V--S--S--T--K--L--V--S--F--H--D--D--S--D--E--D--L--L--H--I-
7621   CTGActccgcagtgcctgcaggggagcacggagccgcgggacagccaagcacctccaacc   7680
       -***........................................................
7681   aaataagacttccactcgatgatgcttctataattttgcctttaacagaaactttcaaaa   7740
       ............................................................
7741   gggaagagtttttgtgatgggggagagggtgaaggaggtcaggccccactccttcctgat   7800
       ............................................................
7801   tgtttacagtcattggaataaggcatggctcagatcggccacagggcggtaccttgtgcc   7860
       ............................................................
7861   cagggttttgccccaagtcctcatttaaaagcataaggccggacgcatctcaaaacagag   7920
       ............................................................
7921   ggctgcattcgaagaaacccttgctgctttagtcccgatagggtatttgaccccgatata   7980
       ............................................................
7981   ttttagcattttaattctctccccctatttattgactttgacaattactcaggtttgaga   8040
       ............................................................
8041   aaaaggaaaaaaaaacagccaccgtttcttcctgccagcaggggtgtgatgtaccagttt   8100
       ............................................................
8101   gtccatcttgagatggtgaggctgtcagtgtatggggcagcttccggcgggatgttgaac   8160
       ............................................................
8161   tggtcattaatgtgtcccctgagttggagctcattctgtctcttttctcttttgctttct   8220
       ............................................................
8221   gtttcttaagggcacacacacgtgcgtgcgagcacacacacacatacgtgcacagggtcc   8280
       ............................................................
8281   ccgagtgcctaggttttggagagtttgcctgttctatgcctttagtcaggaatggctgca   8340
       ............................................................
8341   cctttttgcatgatatcttcaagcctgggcgtacagagcacatttgtcagtatttttgcc   8400
       ............................................................
8401   ggctggtgaattcaaacaacctgcccaaagattgatttgtgtgtttgtgtgtgtgtgtgt   8460
       ............................................................
8461   gtgtgtgtgtgtgtgtgtgagtggagttgaggtgtcagagaaaatgaattttttccagat   8520
       ............................................................
8521   ttggggtataggtctcatctcttcaggttctcatgataccacctttactgtgcttatttt   8580
       ............................................................
8581   tttaagaaaaaagtgttgatcaaccattcgacctataagaagccttaatttgcacagtgt   8640
       ............................................................
8641   gtgacttacagaaactgcatgaaaaatcatgggccagagcctcggccctagcattgcact   8700
       ............................................................
8701   tggcctcatgctggagggaggctgggcgggtacagcgcggaggaggagggaggccaggcg   8760
       ............................................................
8761   ggcatggcgtggaggaggagggaggccgggcggtcacagcatggaggaggagggaggcgc   8820
       ............................................................
8821   tgctggtgttcttattctggcggcagcgcctttcctgccatgtttagtgaatgacttttc   8880
       ............................................................
8881   tcgcattgtagaattgtatatagactctggtgttctattgctgagaagcaaaccgccctg   8940
       ............................................................
8941   cagcatccctcagcctgtaccggtttggctggcttgtttgatttcaacatgagtgtattt   9000
       ............................................................
9001   tttaaaattgatttttctcttcatttttttttcaatcaactttactgtaatataaagtat   9060
       ............................................................
9061   tcaacaatttcaataaaagataaattattaaaa                              9120
       .................................