Imprinted Gene Databases

Homo sapiens: ASCL2

Achaete-scute complex homolog 2
Species Gene Aliases Location Status Expressed Allele
Mus musculus Ascl2 Mash2, 2410083I15Rik  7 69.3 cM  Imprinted Maternal
Homo sapiens ASCL2 ASH2, HASH2, MASH2, bHLHa45  11p15.5  Not Imprinted Biallelic
Sus scrofa ASCL2     Not Imprinted Biallelic
Bos taurus ASCL2 MASH2  29  Imprinted Maternal
1      ctggcggctcttgggactggcggggctgcgcgcggggttagggtgggggtacgggaaggc     60
       ............................................................
61     tcaacccaggacctgcgtaccttgctttgggggcgcactaagcacctgccgggagcaggg    120
       ............................................................
121    ggcgcaccgggaactcgcagatttcgccagttgggcgcactggggatctgtggactgcgt    180
       ............................................................
181    ccgggggatgggctagggggacatgcgcacgctttgggccttacagaatgtgatcgcgcg    240
       ............................................................
241    agggggagggcgaagcgtggcgggagggcgaggcgaaggaaggagggcgtgagaaaggcg    300
       ............................................................
301    acggcggcggcgcggaggagggttatctatacatttaaaaaccagccgcctgcgccgcgc    360
       ............................................................
361    ctgcggagacctgggagagtccggccgcacgcgcgggacacgagcgtcccacgctccctg    420
       ............................................................
421    gcgcgtacggcctgccaccactaggcctcctatccccgggctccagacgacctaggacgc    480
       ............................................................
481    gtgccctggggagttgcctggcggcgccgtgccagaagcccccttggggcgccacagttt    540
       ............................................................
541    tccccgtcgcctccggttcctctgcctgcaccttcctgcggcgcgccgggacctggagcg    600
       ............................................................
601    ggcgggtggatgcaggcgcgATGGACGGCGGCACACTGCCCAGGTCCGCGCCCCCTGCGC    660
       ....................M--D--G--G--T--L--P--R--S--A--P--P--A--P
661    CCCCCGTCCCTGTCGGCTGCGCTGCCCGGCGGAGACCCGCGTCCCCGGAACTGTTGCGCT    720
       --P--V--P--V--G--C--A--A--R--R--R--P--A--S--P--E--L--L--R--C
721    GCAGCCGGCGGCGGCGACCGGCCACCGCAGAGACCGGAGGCGGCGCAGCGGCCGTAGCGC    780
       --S--R--R--R--R--P--A--T--A--E--T--G--G--G--A--A--A--V--A--R
781    GGCGCAATGAGCGCGAGCGCAACCGCGTGAAGCTGGTGAACTTGGGCTTCCAGGCGCTGC    840
       --R--N--E--R--E--R--N--R--V--K--L--V--N--L--G--F--Q--A--L--R
841    GGCAGCACGTGCCGCACGGCGGCGCCAGCAAGAAGCTGAGCAAGGTGGAGACGCTGCGCT    900
       --Q--H--V--P--H--G--G--A--S--K--K--L--S--K--V--E--T--L--R--S
901    CAGCCGTGGAGTACATCCGCGCGCTGCAGCGCCTGCTGGCCGAGCACGACGCCGTGCGCA    960
       --A--V--E--Y--I--R--A--L--Q--R--L--L--A--E--H--D--A--V--R--N
961    ACGCGCTGGCGGGAGGGCTGAGGCCGCAGGCCGTGCGGCCGTCTGCGCCCCGCGGGCCGC   1020
       --A--L--A--G--G--L--R--P--Q--A--V--R--P--S--A--P--R--G--P--P
1021   CAGGGACCACCCCGGTCGCCGCCTCGCCCTCCCGCGCTTCTTCGTCCCCGGGCCGCGGGG   1080
       --G--T--T--P--V--A--A--S--P--S--R--A--S--S--S--P--G--R--G--G
1081   GCAGCTCGGAGCCCGGCTCCCCGCGTTCCGCCTACTCGTCGGACGACAGCGGCTGCGAAG   1140
       --S--S--E--P--G--S--P--R--S--A--Y--S--S--D--D--S--G--C--E--G
1141   GCGCGCTGAGTCCTGCGGAGCGCGAGCTACTCGACTTCTCCAGCTGGTTAGGGGGCTACT   1200
       --A--L--S--P--A--E--R--E--L--L--D--F--S--S--W--L--G--G--Y--*
1201   GAgcgccctcgacctatgagcctcagccccggaagccgagcgagcggccggcgcgctcat   1260
       **..........................................................
1261   cgccggggagcccgccaggtggaccggcccgcgctccgcccccagcgagccggggaccca   1320
       ............................................................
1321   cccaccaccccccgcaccgccgacgccgcctcgttcgtccggcccagcctgaccaatgcc   1380
       ............................................................
1381   gcggtggaaacgggcttggagctggccccataagggctggcggcttcctccgacgccgcc   1440
       ............................................................
1441   cctccccacagcttctcgactgcagtggggcggggggcaccaacacttggagatttttcc   1500
       ............................................................
1501   ggaggggagaggattttctaagggcacagagaatccattttctacacattaacttgagct   1560
       ............................................................
1561   gctggagggacactgctggcaaacggagacctatttttgtacaaagaacccttgacctgg   1620
       ............................................................
1621   ggcgtaataaagatgacctggacccctgcccccactatctggagttttccatgctggcca   1680
       ............................................................
1681   agatctggacacgagcagtccctgaggggcggggtccctggcgtgaggcccccgtgacag   1740
       ............................................................
1741   cccaccctggggtgggtttgtgggcactgctgctctgctagggagaagcctgtgtggggc   1800
       ............................................................
1801   acacctcttcaagggagcgtgaactttataaataaatcagttctgtttaaaaaaaaaaaa   1860
       ............................................................
1861   aaaa                                                           1920
       ....