Imprinted Gene Databases

Sus scrofa: ASCL2

Achaete-scute complex homolog 2
Species Gene Aliases Location Status Expressed Allele
Mus musculus Ascl2 Mash2, 2410083I15Rik  7 69.3 cM  Imprinted Maternal
Homo sapiens ASCL2 ASH2, HASH2, MASH2, bHLHa45  11p15.5  Not Imprinted Biallelic
Sus scrofa ASCL2     Not Imprinted Biallelic
Bos taurus ASCL2 MASH2  29  Imprinted Maternal
1      acagtgccagatcgtcgctgagacgggactgtttctccgcccgcggttcctcgccccgca     60
       ............................................................
61     cctttctgctgcgcgccgggtctcggaggaggcgccgggagagtggatgcgggcgagATG    120
       .........................................................M--
121    GACAGCGGCGCACTGCCCCGGCCGTCGCCCCGCGCGCCTGGCGTCTCGGGCTGCTGCGCG    180
       D--S--G--A--L--P--R--P--S--P--R--A--P--G--V--S--G--C--C--A--
181    GCTCGGAGGCGACCCGAGTCCCCAGAGCTGCTCCGCTGCAGCCGGCGGCGGCGGCCAGGC    240
       A--R--R--R--P--E--S--P--E--L--L--R--C--S--R--R--R--R--P--G--
241    GCGGTGGAGACCGGCAACGGCGCGGCAGCCGTGGCGCGACGCAACGAGCGCGAGCGCAAC    300
       A--V--E--T--G--N--G--A--A--A--V--A--R--R--N--E--R--E--R--N--
301    CGCGTGAAGCTGGTGAACTTGGGGTTCCAGGCGCTGCGGCAGCACGTGCCTCACGGCGGC    360
       R--V--K--L--V--N--L--G--F--Q--A--L--R--Q--H--V--P--H--G--G--
361    GCCAGCAAGAAGCTGAGCAAGGTGGAGACGCTGCGCTCGGCCGTGGAGTACACCCGCGCG    420
       A--S--K--K--L--S--K--V--E--T--L--R--S--A--V--E--Y--T--R--A--
421    CTGCAGCGCCTGCTGGCCGAGCATGATGCGGTGCGTGCCGCCTTGGCCGGGGGGCTGCTG    480
       L--Q--R--L--L--A--E--H--D--A--V--R--A--A--L--A--G--G--L--L--
481    GCGCCAGCGGCGCGCCACCCCCTGCCCCGCGGGCCGCCCGGGACCCCCGCCGCCACCGCC    540
       A--P--A--A--R--H--P--L--P--R--G--P--P--G--T--P--A--A--T--A--
541    TCGCCTTCCTGCGCCTCGTCGTCCCCAGGCCGTGGGCACAGCTCGGAGCCCGGGTCCCCC    600
       S--P--S--C--A--S--S--S--P--G--R--G--H--S--S--E--P--G--S--P--
601    CGTTCCGCCTACTCGTCGGACGACAGCGGCTGTGAGGGCGCGCTGAGCCCCGCCGAGCGC    660
       R--S--A--Y--S--S--D--D--S--G--C--E--G--A--L--S--P--A--E--R--
661    GAGCTGCTCGACTTCTCCAGCTGGTTAGGGGGCTACTGAgcgcttcaccccgagcggcgg    720
       E--L--L--D--F--S--S--W--L--G--G--Y--***.....................
721    caagcgcccaccacctgggagccggcgcgctggcctggctggactcgtccctgtcctatc    780
       ............................................................
781    tgcgggtcaagccaccaccgagccggggctcgcgccatcgcccccccccccggccgtcca    840
       ............................................................
841    gcctgaccaagggctagtgtggaatggggtcccgccagacctcactggcggcagcttcct    900
       ............................................................
901    cgcccactccccttgcccccagaggccttcccctggaacggggctgcagcaggacacttg    960
       ............................................................
961    gaggcttgacgaggaggggatcttgggatgacacagattatctattttttactcatggac   1020
       ............................................................
1021   ttgaactgcccagggaca                                             1080
       ..................