Imprinted Gene Databases

Ovis aries: IGF2

Insulin-like growth factor 2

Young et al. Mech. Dev. 120: 1433-1442, 2003

Species Gene Aliases Location Status Expressed Allele
Mus musculus Igf2 Mpr, M6pr, Peg2, Igf-2, Igf-II, AL033362  7 69.09 cM  Imprinted Paternal
Bos taurus IGF2 IGF2, MGC140034  29qter  Imprinted Paternal
Tachyglossus aculeatus IGF2     Not Imprinted Biallelic
Sus scrofa IGF2 IGF-II  2p  Imprinted Paternal
Gallus gallus domesticus IGF2 IGF-II  Not Imprinted Biallelic
Rattus norvegicus Igf2 IGFII, RNIGF2  1q41  Imprinted Paternal
Ornithorhynchus anatinus IGF2     Not Imprinted Biallelic
Ovis aries IGF2 IGF2, IGF-II  21  Imprinted Paternal
Osteichthyes IGF2     Not Imprinted Biallelic
Homo sapiens IGF2 INSIGF, pp9974, C11orf43, FLJ22066, FLJ44734  11p15.5  Imprinted Paternal
Macropus eugenii IGF2     Imprinted Paternal
Didelphis virginiana IGF2     Imprinted Paternal
1      gctcacgcaggtggccctgtgcgcgcagattggggcaggggtgccgcaggagctgagggg     60
       ............................................................
61     acgaagagtcactgttcaccttgaggacgaggaggcggccttcagctcccagccccaggg    120
       ............................................................
121    ccccacacccaggccaggtcagccctttgcccaggctgccccccggccagagcctgcagc    180
       ............................................................
181    aggccagaaaccccagcccgggaagtcagctgctgtgacccgtggccctcaatccccacc    240
       ............................................................
241    tgctcagaactgagcccacggccccagcccgcagagacatcaATGGGGATCACAGCAGGA    300
       ..........................................M--G--I--T--A--G--
301    AAGTCGATGCTGGCGCTTCTTGCCTTCTTGGCCTTCGCCTCGTGCTGCTATGCTGCTTAC    360
       K--S--M--L--A--L--L--A--F--L--A--F--A--S--C--C--Y--A--A--Y--
361    CGCCCCAGCGAGACTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTTGTCTGTGGG    420
       R--P--S--E--T--L--C--G--G--E--L--V--D--T--L--Q--F--V--C--G--
421    GACCGCGGCTTCTACTTCAGCCGACCATCCAGCCGCATAAACCGACGCAGCCGTGGCATC    480
       D--R--G--F--Y--F--S--R--P--S--S--R--I--N--R--R--S--R--G--I--
481    GTGGAAGAGTGTTGCTTCCGAAGCTGCGACCTGGCCCTGCTGGAGACTTACTGTGCCGCC    540
       V--E--E--C--C--F--R--S--C--D--L--A--L--L--E--T--Y--C--A--A--
541    CCCGCCAAGTCCGAGAGGGATGTGTCTGCCTCTACGACCGTGCTTCCGGACGACTTCACA    600
       P--A--K--S--E--R--D--V--S--A--S--T--T--V--L--P--D--D--F--T--
601    GCATACCCCGTGGGCAAGTTCTTCCAATCTGACACCTGGAAGCAGTCCACCCAGCGCCTG    660
       A--Y--P--V--G--K--F--F--Q--S--D--T--W--K--Q--S--T--Q--R--L--
661    CGCAGGGGCCTGCCCGCTTTCCTGCGAGCACGCCGGGGTCGCACGCTCGCCAAGGAGCTG    720
       R--R--G--L--P--A--F--L--R--A--R--R--G--R--T--L--A--K--E--L--
721    GAGGCGCTCAGAGAGGCCAAGAGTCACCGTCCGCTGATCGCCCTGCCTACCCAGGACCCT    780
       E--A--L--R--E--A--K--S--H--R--P--L--I--A--L--P--T--Q--D--P--
781    GCCACCCACGGGGGCGCCTCTTCCGAGGCATCCAGCGATTAGaagtgagccaaagtgtcg    840
       A--T--H--G--G--A--S--S--E--A--S--S--D--***..................
841    taattctgccaagtgacaccatctacctcgcgccgtcctcctgaccgggactgccccact    900
       ............................................................
901    aggtctctctctgaaatccctgtaccgtcctgtctgcgggctcccctgacccagcctctg    960
       ............................................................
961    tgccccaacctccccacgtcaggcaagtccccctcggccccctccatctggccgagggga   1020
       ............................................................
1021   tcagaacaacatctctaaaaatgtacaaaaccaattggctttaaatatccccccaaatta   1080
       ............................................................
1081   tcaccccccaaattacccccaaattatacaaccaaaattgcaatcataaacccctcaatc   1140
       ............................................................
1141   agcccccctgaaatgaattggctttttagcaacaccagaaaagcaaactagctttccaaa   1200
       ............................................................
1201   aacttcttaaaaaaaaaaaaaaaaa                                      1260
       .........................