Imprinted Gene Databases

Ovis aries: IGF2

Insulin-like growth factor 2

Young et al. Mech. Dev. 120: 1433-1442, 2003

Species Gene Aliases Location Status Expressed Allele
Tachyglossus aculeatus IGF2     Not Imprinted Biallelic
Sus scrofa IGF2 IGF-II  2p  Imprinted Paternal
Didelphis virginiana IGF2     Imprinted Paternal
Mus musculus Igf2 Mpr, M6pr, Peg2, Igf-2, Igf-II, AL033362  7 69.09 cM  Imprinted Paternal
Ornithorhynchus anatinus IGF2     Not Imprinted Biallelic
Gallus gallus domesticus IGF2 IGF-II  Not Imprinted Biallelic
Homo sapiens IGF2 INSIGF, pp9974, C11orf43, FLJ22066, FLJ44734  11p15.5  Imprinted Paternal
Osteichthyes IGF2     Not Imprinted Biallelic
Bos taurus IGF2 IGF2, MGC140034  29qter  Imprinted Paternal
Ovis aries IGF2 IGF2, IGF-II  21  Imprinted Paternal
Macropus eugenii IGF2     Imprinted Paternal
Rattus norvegicus Igf2 IGFII, RNIGF2  1q41  Imprinted Paternal
1      gctcacgcaggtggccctgtgcgcgcagattggggcaggggtgccgcaggagctgagggg     60
61     acgaagagtcactgttcaccttgaggacgaggaggcggccttcagctcccagccccaggg    120
121    ccccacacccaggccaggtcagccctttgcccaggctgccccccggccagagcctgcagc    180
181    aggccagaaaccccagcccgggaagtcagctgctgtgacccgtggccctcaatccccacc    240
241    tgctcagaactgagcccacggccccagcccgcagagacatcaATGGGGATCACAGCAGGA    300
841    taattctgccaagtgacaccatctacctcgcgccgtcctcctgaccgggactgccccact    900
901    aggtctctctctgaaatccctgtaccgtcctgtctgcgggctcccctgacccagcctctg    960
961    tgccccaacctccccacgtcaggcaagtccccctcggccccctccatctggccgagggga   1020
1021   tcagaacaacatctctaaaaatgtacaaaaccaattggctttaaatatccccccaaatta   1080
1081   tcaccccccaaattacccccaaattatacaaccaaaattgcaatcataaacccctcaatc   1140
1141   agcccccctgaaatgaattggctttttagcaacaccagaaaagcaaactagctttccaaa   1200
1201   aacttcttaaaaaaaaaaaaaaaaa                                      1260