Imprinted Gene Databases

Mus musculus: Ntm

Neurotrimin
Species Gene Aliases Location Status Expressed Allele
Homo sapiens NTM HNT, NTRI, IGLON2  11q25  Imprinted Maternal
Mus musculus Ntm Hnt, Igdcc2, R75390, 6230410L23Rik, B230210G24Rik  Imprinted
1      gagtatgagtggagataattacggagaagtcagactctctctcgccctcggcttccttgt     60
       ............................................................
61     tgtgtccttcagcaaaacagtggatttaaatctcctcggactagcttgagagcaacacaa    120
       ............................................................
121    tctatcaggaggaaaaaagaaagagagacagaggaagaaaaaaaaaccgatcctgacaaa    180
       ............................................................
181    aaagaagaaaaagaagaaaaaatATGAAAACCATCCAGGCAAAAATGCACAATTCTATCT    240
       .......................M--K--T--I--Q--A--K--M--H--N--S--I--S
241    CGTGGGCAATCTTCACGGGGCTGGCGGCTCTGTGCCTCTTCCAAGGAGTGCCGGTGCGTA    300
       --W--A--I--F--T--G--L--A--A--L--C--L--F--Q--G--V--P--V--R--S
301    GCGGAGATGCCACCTTTCCCAAAGCTATGGACAACGTGACGGTCAGGCAGGGGGAGAGCG    360
       --G--D--A--T--F--P--K--A--M--D--N--V--T--V--R--Q--G--E--S--A
361    CCACCCTCAGGTGCACAATTGACAACCGAGTCACCCGGGTGGCCTGGCTAAACCGCAGTA    420
       --T--L--R--C--T--I--D--N--R--V--T--R--V--A--W--L--N--R--S--T
421    CCATCCTCTATGCTGGAAATGACAAGTGGTGCCTAGATCCTCGTGTGGTCCTCCTGAGTA    480
       --I--L--Y--A--G--N--D--K--W--C--L--D--P--R--V--V--L--L--S--N
481    ACACCCAGACCCAGTACAGCATTGAGATCCAGAATGTGGATGTGTACGATGAGGGCCCTT    540
       --T--Q--T--Q--Y--S--I--E--I--Q--N--V--D--V--Y--D--E--G--P--Y
541    ATACCTGCTCGGTACAGACAGACAACCACCCTAAGACCTCCAGGGTCCACCTCATTGTAC    600
       --T--C--S--V--Q--T--D--N--H--P--K--T--S--R--V--H--L--I--V--Q
601    AAGTATCTCCCAAAATTGTAGAGATTTCTTCAGATATCTCCATTAATGAAGGGAACAACA    660
       --V--S--P--K--I--V--E--I--S--S--D--I--S--I--N--E--G--N--N--I
661    TCAGCCTCACTTGCATAGCCACAGGTAGACCGGAGCCTACAGTAACCTGGAGACATATTT    720
       --S--L--T--C--I--A--T--G--R--P--E--P--T--V--T--W--R--H--I--S
721    CTCCCAAGGCCGTTGGCTTTGTGAGTGAGGATGAGTACCTGGAGATCCAGGGCATCACTC    780
       --P--K--A--V--G--F--V--S--E--D--E--Y--L--E--I--Q--G--I--T--R
781    GGGAACAGTCAGGCGAGTACGAGTGCAGCGCCTCCAACGACGTGGCGGCACCAGTGGTAC    840
       --E--Q--S--G--E--Y--E--C--S--A--S--N--D--V--A--A--P--V--V--R
841    GAAGAGTGAAGGTCACCGTGAACTATCCACCATACATCTCAGAAGCTAAGGGCACAGGTG    900
       --R--V--K--V--T--V--N--Y--P--P--Y--I--S--E--A--K--G--T--G--V
901    TCCCCGTGGGGCAGAAGGGGACTCTGCAGTGTGAAGCTTCCGCAGTCCCTTCAGCAGAAT    960
       --P--V--G--Q--K--G--T--L--Q--C--E--A--S--A--V--P--S--A--E--F
961    TTCAATGGTTCAAGGATGACAAAAGACTGGTCGAAGGAAAGAAGGGAGTCAAAGTGGAAA   1020
       --Q--W--F--K--D--D--K--R--L--V--E--G--K--K--G--V--K--V--E--N
1021   ACAGACCTTTCCTTTCAAAACTCACCTTTTTCAACGTCTCTGAACATGACTATGGGAACT   1080
       --R--P--F--L--S--K--L--T--F--F--N--V--S--E--H--D--Y--G--N--Y
1081   ACACATGTGTGGCCTCCAACAAGCTGGGTCACACCAACGCCAGCATCATGCTATTTGGTC   1140
       --T--C--V--A--S--N--K--L--G--H--T--N--A--S--I--M--L--F--G--P
1141   CCGGTGCTGTCAGTGAGGTCAACAATGGGACATCAAGGAGGGCAGGCTGCATTTGGCTCC   1200
       --G--A--V--S--E--V--N--N--G--T--S--R--R--A--G--C--I--W--L--L
1201   TCCCTCTTCTGGTCTTACACCTGCTCCTCAAATTTTGAtgtgagtgccccttccctgctg   1260
       --P--L--L--V--L--H--L--L--L--K--F--***......................
1261   gggagagctgctgccaccgcatctcaatacaacagcactgcaaaatgaagcaacaagtca   1320
       ............................................................
1321   gaatcaaatgaaattccgagaatcacagccaatgagacagaaattcgagggagggggaca   1380
       ............................................................
1381   aagcatactgtggtaaaggggaaaaaaaggtttaagaaaaggaaatttggaaattgcctt   1440
       ............................................................
1441   gcagatatttcggtaccgctgagttttctttcttttcccaagtgggaagaaggcacacct   1500
       ............................................................
1501   agcttggacccacccacaagctgcactgtgtgacctctctgttgccagggtgggcaaggg   1560
       ............................................................
1561   ctcagccactctgcccactaaagtgccccaccatgaaacattctggagttggccatccca   1620
       ............................................................
1621   aatttcatcggtccatagacacaagcacagagcaagaaacaagggccttagatgtgccac   1680
       ............................................................
1681   gaagggccctttggtgggctgtgtgacagtcgcgtgtgtcatgaagtgtgaaatctggag   1740
       ............................................................
1741   gaagaaaaaaaaacaagagcaaaagaaaagaaaagaaaagaagagaagagaagagaagag   1800
       ............................................................
1801   aagagaag                                                       1860
       ........