Imprinted Gene Databases

Homo sapiens: ZIM2

Zinc finger, imprinted 2
Species Gene Aliases Location Status Expressed Allele
Bos taurus ZIM2   18  Not Imprinted Biallelic
Homo sapiens ZIM2 ZNF656  19q13.4  Imprinted Paternal
Mus musculus Zim2 1700116N21Rik  7 A1  Imprinted Maternal
1      acattactaatactataaataaccaacatcatacgaatatacagggtcgtggcggcagtg     60
       ............................................................
61     ggcagtgggcagtgcggctatctcgttgccccggctaatttggtataaatgaataggtta    120
       ............................................................
121    agattcggttttgggtagctaccttatgccaatgtgcgcacccgaaaagtgaccccgttc    180
       ............................................................
181    cgcgttccggcagtgggcagtgggcagtgggcagtgggcagtgggcagtgggcagtgggc    240
       ............................................................
241    agtggggtgcagaagtctgggcagctgcgggaggagaggtttgggaggcgcgggagatgt    300
       ............................................................
301    ccaccctgggctggtggcgccgccgggcgccgggcgccatgagggtgcgctaggcggctg    360
       ............................................................
361    ttcgtgcccgaggctgcgcaGCACTGAGCTTTGCCTTCTTGATCTTCCGTCCTTCTTGGA    420
       ....................M--Y--Q--P--E--D--D--N--N--S--D--V--T--S
421    GACGACTGGCGAGAGGAAGAGGGACTAGGTCCAAACGCTAGGTGGCTGGGTCCAGCCGGA    480
       --D--D--D--M--T--R--N--R--R--E--S--S--P--P--H--S--V--H--S--F
481    GACCCGCACCAAGGAGGAGATCATCGAGCTCTTGGTCCTTGAGCAGTACCTGACCATCAT    540
       --S--G--D--R--D--W--D--R--R--G--R--S--R--D--M--E--P--R--D--R
541    CCCTGAAAAGCTCAAGCCTTGGGTGCGAGCAAAAAAGCCGGAGAACTGTGAGAAGCTCGT    600
       --W--S--H--T--R--N--P--R--S--R--M--P--P--R--D--L--S--L--P--V
601    CACTCTGCTGGAGAATTACAAGGAGATGTACCAACCAGAAGACGACAACAACAGTGACGT    660
       --V--A--K--T--S--F--E--M--D--R--E--D--D--R--D--S--R--A--Y--E
661    GACCAGCGACGACGACATGACCCGGAACAGAAGAGAGTCCTCACCACCTCACTCAGTCCA    720
       --S--R--S--Q--D--A--E--S--Y--Q--N--V--V--D--L--A--E--D--R--K
721    TTCTTTCAGTGGTGACCGGGACTGGGACCGGAGGGGCAGAAGCAGAGACATGGAGCCACG    780
       --P--H--N--T--I--Q--D--N--M--E--N--Y--R--K--L--L--S--L--G--F
781    AGACCGCTGGTCCCACACCAGGAACCCAAGAAGCAGGATGCCTCCGCGGGATCTTTCCCT    840
       --L--A--Q--D--S--V--P--A--E--K--R--N--T--E--M--L--D--N--L--P
841    TCCTGTGGTGGCGAAAACAAGCTTTGAAATGGACAGAGAGGACGACAGGGACTCCAGGGC    900
       --S--A--G--S--Q--F--P--D--F--K--H--L--G--T--F--L--V--F--E--E
901    TTATGAGTCCCGATCTCAGGATGCTGAATCATACCAAAATGTGGTGGACCTCGCTGAGGA    960
       --L--V--T--F--E--D--V--L--V--D--F--S--P--E--E--L--S--S--L--S
961    CAGGAAACCTCACAACACAATCCAGGACAACATGGAAAACTACAGGAAGCTGCTCTCCCT   1020
       --A--A--Q--R--N--L--Y--R--E--V--M--L--E--N--Y--R--N--L--V--S
1021   CGGTTTCCTTGCTCAGGACTCTGTCCCTGCAGAAAAGAGGAACACAGAGATGTTAGACAA   1080
       --L--G--H--Q--F--S--K--P--D--I--I--S--R--L--E--E--E--E--S--Y
1081   TCTGCCATCTGCTGGGTCCCAGTTCCCGGACTTCAAACACTTAGGAACATTTCTGGTGTT   1140
       --A--M--E--T--D--S--R--H--T--V--I--C--Q--G--E--S--H--D--D--P
1141   TGAGGAGTTGGTGACCTTCGAGGATGTGCTTGTGGACTTCAGCCCAGAGGAACTTAGTTC   1200
       --L--E--P--H--Q--G--N--Q--E--K--L--L--T--P--I--T--M--N--D--P
1201   CCTTAGTGCTGCTCAGAGAAACCTCTACAGGGAGGTGATGCTGGAGAATTACCGGAACCT   1260
       --K--T--L--T--P--E--R--S--Y--G--S--D--E--F--E--R--S--S--N--L
1261   GGTCTCCCTGGGGCACCAGTTCTCTAAACCTGACATTATCTCACGCCTGGAAGAGGAGGA   1320
       --S--K--Q--S--K--D--P--L--G--K--D--P--Q--E--G--T--A--P--G--I
1321   ATCATATGCAATGGAGACAGACAGCAGACATACAGTGATTTGTCAAGGAGAGTCTCATGA   1380
       --C--T--S--P--Q--S--A--S--Q--E--N--K--H--N--R--C--E--F--C--K
1381   TGATCCATTGGAACCACACCAGGGCAACCAAGAGAAACTTTTGACTCCTATAACAATGAA   1440
       --R--T--F--S--T--Q--V--A--L--R--R--H--E--R--I--H--T--G--K--K
1441   TGACCCCAAGACCCTCACTCCGGAAAGAAGCTATGGCAGTGATGAATTTGAGAGAAGCTC   1500
       --P--Y--E--C--K--Q--C--A--E--A--F--Y--L--M--P--H--L--N--R--H
1501   TAATCTTAGTAAACAATCAAAGGATCCTCTAGGAAAGGATCCCCAGGAAGGCACTGCTCC   1560
       --Q--K--T--H--S--G--R--K--T--S--G--C--N--E--G--R--K--P--S--V
1561   TGGAATATGTACGAGTCCCCAGTCAGCATCCCAAGAGAACAAACACAACAGATGTGAATT   1620
       --Q--C--A--N--L--C--E--R--V--R--I--H--S--Q--E--D--Y--F--E--C
1621   TTGCAAACGAACCTTTAGTACGCAAGTAGCCCTTAGGAGACACGAACGGATCCATACTGG   1680
       --F--Q--C--G--K--A--F--L--Q--N--V--H--L--L--Q--H--L--K--A--H
1681   GAAGAAACCCTATGAATGTAAACAGTGTGCTGAAGCCTTCTATCTCATGCCACACCTCAA   1740
       --E--A--A--R--V--L--P--P--G--L--S--H--S--K--T--Y--L--I--R--Y
1741   CAGACATCAGAAGACCCATTCTGGTAGGAAGACTTCTGGCTGCAATGAAGGTAGAAAGCC   1800
       --Q--R--K--H--D--Y--V--G--E--R--A--C--Q--C--C--D--C--G--R--V
1801   TTCCGTCCAGTGTGCGAATCTCTGTGAACGTGTAAGAATTCACAGTCAGGAGGACTACTT   1860
       --F--S--R--N--S--Y--L--I--Q--H--Y--R--T--H--T--Q--E--R--P--Y
1861   TGAATGTTTTCAGTGCGGCAAAGCTTTTCTCCAGAATGTGCATCTTCTTCAACATCTCAA   1920
       --Q--C--Q--L--C--G--K--C--F--G--R--P--S--Y--L--T--Q--H--Y--Q
1921   AGCCCATGAGGCAGCAAGAGTCCTTCCTCCTGGGTTGTCCCACAgcaagacatacttaat   1980
       --L--H--S--Q--E--K--T--V--E--C--D--H--C--***................
1981   tcgttatcagcggaaacatgactacgttggagagagagcctgccagtgttgtgactgtgg   2040
       ............................................................
2041   cagagtcttcagtcggaattcatatctcattcagcattatagaactcacactcaagagag   2100
       ............................................................
2101   gccttaccagtgtcagctatgtgggaaatgtttcggccgaccctcatacctcactcaaca   2160
       ............................................................
2161   ttatcaactccattctcaagagaaaactgttgagtgcgatcactgttgagaaacctttag   2220
       ............................................................
2221   tcacagcacacacttttctcaacattattggcttcctcctagagtgttgtgagtgtgaga   2280
       ............................................................
2281   aggcctttcactagccccaccttgttaacaacttgaacattcatcaaagtgtggtaaaaa   2340
       ............................................................
2341   aaaaaaaaaaaaaaaaaa                                             2400
       ..................