Imprinted Gene Databases

Homo sapiens: UBE3A

Ubiquitin protein ligase E3A
Species Gene Aliases Location Status Expressed Allele
Macaca mulatta UBE3A   Tissue Dependent Maternal
Homo sapiens UBE3A AS, ANCR, E6-AP, HPVE6A, EPVE6AP, FLJ26981  15q11-q13  Imprinted Maternal
Mus musculus Ube3a Hpve6a, KIAA4216, mKIAA4216, 4732496B02, 5830462N02Rik, A130086L21Rik  7 28.65 cM  Imprinted Maternal
1      ATGGAGAAGCTGCACCAGTGTTATTGGAAATCAGGAGAACCTCAGTCTGACGACATTGAA     60
       M--E--K--L--H--Q--C--Y--W--K--S--G--E--P--Q--S--D--D--I--E--
61     GCTAGCCGAATGAAGCGAGCAGCTGCAAAGCATCTAATAGAACGCTACTACCACCAGTTA    120
       A--S--R--M--K--R--A--A--A--K--H--L--I--E--R--Y--Y--H--Q--L--
121    ACTGAGGGCTGTGGAAATGAAGCCTGCACGAATGAGTTTTGTGCTTCCTGTCCAACTTTT    180
       T--E--G--C--G--N--E--A--C--T--N--E--F--C--A--S--C--P--T--F--
181    CTTCGTATGGATAATAATGCAGCAGCTATTAAAGCCCTCGAGCTTTATAAGATTAATGCA    240
       L--R--M--D--N--N--A--A--A--I--K--A--L--E--L--Y--K--I--N--A--
241    AAACTCTGTGATCCTCATCCCTCCAAGAAAGGAGCAAGCTCAGCTTACCTTGAGAACTCG    300
       K--L--C--D--P--H--P--S--K--K--G--A--S--S--A--Y--L--E--N--S--
301    AAAGGTGCCCCCAACAACTCCTGCTCTGAGATAAAAATGAACAAGAAAGGCGCTAGAATT    360
       K--G--A--P--N--N--S--C--S--E--I--K--M--N--K--K--G--A--R--I--
361    GATTTTAAAGATGTGACTTACTTAACAGAAGAGAAGGTATATGAAATTCTTGAATTATGT    420
       D--F--K--D--V--T--Y--L--T--E--E--K--V--Y--E--I--L--E--L--C--
421    AGAGAAAGAGAGGATTATTCCCCTTTAATCCGTGTTATTGGAAGAGTTTTTTCTAGTGCT    480
       R--E--R--E--D--Y--S--P--L--I--R--V--I--G--R--V--F--S--S--A--
481    GAGGCATTGGTACAGAGCTTCCGGAAAGTTAAACAACACACCAAGGAAGAACTGAAATCT    540
       E--A--L--V--Q--S--F--R--K--V--K--Q--H--T--K--E--E--L--K--S--
541    CTTCAAGCAAAAGATGAAGACAAAGATGAAGATGAAAAGGAAAAAGCTGCATGTTCTGCT    600
       L--Q--A--K--D--E--D--K--D--E--D--E--K--E--K--A--A--C--S--A--
601    GCTGCTATGGAAGAAGACTCAGAAGCATCTTCCTCAAGGATAGGTGATAGCTCACAGGGA    660
       A--A--M--E--E--D--S--E--A--S--S--S--R--I--G--D--S--S--Q--G--
661    GACAACAATTTGCAAAAATTAGGCCCTGATGATGTGTCTGTGGATATTGATGCCATTAGA    720
       D--N--N--L--Q--K--L--G--P--D--D--V--S--V--D--I--D--A--I--R--
721    AGGGTCTACACCAGATTGCTCTCTAATGAAAAAATTGAAACTGCCTTTCTCAATGCACTT    780
       R--V--Y--T--R--L--L--S--N--E--K--I--E--T--A--F--L--N--A--L--
781    GTATATTTGTCACCTAACGTGGAATGTGACTTGACGTATCACAATGTATACTCTCGAGAT    840
       V--Y--L--S--P--N--V--E--C--D--L--T--Y--H--N--V--Y--S--R--D--
841    CCTAATTATCTGAATTTGTTCATTATCGTAATGGAGAATAGAAATCTCCACAGTCCTGAA    900
       P--N--Y--L--N--L--F--I--I--V--M--E--N--R--N--L--H--S--P--E--
901    TATCTGGAAATGGCTTTGCCATTATTTTGCAAAGCGATGAGCAAGCTACCCCTTGCAGCC    960
       Y--L--E--M--A--L--P--L--F--C--K--A--M--S--K--L--P--L--A--A--
961    CAAGGAAAACTGATCAGACTGTGGTCTAAATACAATGCAGACCAGATTCGGAGAATGATG   1020
       Q--G--K--L--I--R--L--W--S--K--Y--N--A--D--Q--I--R--R--M--M--
1021   GAGACATTTCAGCAACTTATTACTTATAAAGTCATAAGCAATGAATTTAACAGTCGAAAT   1080
       E--T--F--Q--Q--L--I--T--Y--K--V--I--S--N--E--F--N--S--R--N--
1081   CTAGTGAATGATGATGATGCCATTGTTGCTGCTTCGAAGTGCTTGAAAATGGTTTACTAT   1140
       L--V--N--D--D--D--A--I--V--A--A--S--K--C--L--K--M--V--Y--Y--
1141   GCAAATGTAGTGGGAGGGGAAGTGGACACAAATCACAATGAAGAAGATGATGAAGAGCCC   1200
       A--N--V--V--G--G--E--V--D--T--N--H--N--E--E--D--D--E--E--P--
1201   ATCCCTGAGTCCAGCGAGCTGACACTTCAGGAACTTTTGGGAGAAGAAAGAAGAAACAAG   1260
       I--P--E--S--S--E--L--T--L--Q--E--L--L--G--E--E--R--R--N--K--
1261   AAAGGTCCTCGAGTGGACCCCCTGGAAACTGAACTTGGTGTTAAAACCCTGGATTGTCGA   1320
       K--G--P--R--V--D--P--L--E--T--E--L--G--V--K--T--L--D--C--R--
1321   AAACCACTTATCCCTTTTGAAGAGTTTATTAATGAACCACTGAATGAGGTTCTAGAAATG   1380
       K--P--L--I--P--F--E--E--F--I--N--E--P--L--N--E--V--L--E--M--
1381   GATAAAGATTATACTTTTTTCAAAGTAGAAACAGAGAACAAATTCTCTTTTATGACATGT   1440
       D--K--D--Y--T--F--F--K--V--E--T--E--N--K--F--S--F--M--T--C--
1441   CCCTTTATATTGAATGCTGTCACAAAGAATTTGGGATTATATTATGACAATAGAATTCGC   1500
       P--F--I--L--N--A--V--T--K--N--L--G--L--Y--Y--D--N--R--I--R--
1501   ATGTACAGTGAACGAAGAATCACTGTTCTCTACAGCTTAGTTCAAGGACAGCAGTTGAAT   1560
       M--Y--S--E--R--R--I--T--V--L--Y--S--L--V--Q--G--Q--Q--L--N--
1561   CCATATTTGAGACTCAAAGTTAGACGTGACCATATCATAGATGATGCACTTGTCCGGCTA   1620
       P--Y--L--R--L--K--V--R--R--D--H--I--I--D--D--A--L--V--R--L--
1621   GAGATGATCGCTATGGAAAATCCTGCAGACTTGAAGAAGCAGTTGTATGTGGAATTTGAA   1680
       E--M--I--A--M--E--N--P--A--D--L--K--K--Q--L--Y--V--E--F--E--
1681   GGAGAACAAGGAGTTGATGAGGGAGGTGTTTCCAAAGAATTTTTTCAGCTGGTTGTGGAG   1740
       G--E--Q--G--V--D--E--G--G--V--S--K--E--F--F--Q--L--V--V--E--
1741   GAAATCTTCAATCCAGATATTGGTATGTTCACATACGATGAATCTACAAAATTGTTTTGG   1800
       E--I--F--N--P--D--I--G--M--F--T--Y--D--E--S--T--K--L--F--W--
1801   TTTAATCCATCTTCTTTTGAAACTGAGGGTCAGTTTACTCTGATTGGCATAGTACTGGGT   1860
       F--N--P--S--S--F--E--T--E--G--Q--F--T--L--I--G--I--V--L--G--
1861   CTGGCTATTTACAATAACTGTATACTGGATGTACATTTTCCCATGGTTGTCTACAGGAAG   1920
       L--A--I--Y--N--N--C--I--L--D--V--H--F--P--M--V--V--Y--R--K--
1921   CTAATGGGGAAAAAAGGAACTTTTCGTGACTTGGGAGACTCTCACCCAGTTCTATATCAG   1980
       L--M--G--K--K--G--T--F--R--D--L--G--D--S--H--P--V--L--Y--Q--
1981   AGTTTAAAAGATTTATTGGAGTATGAAGGGAATGTGGAAGATGACATGATGATCACTTTC   2040
       S--L--K--D--L--L--E--Y--E--G--N--V--E--D--D--M--M--I--T--F--
2041   CAGATATCACAGACAGATCTTTTTGGTAACCCAATGATGTATGATCTAAAGGAAAATGGT   2100
       Q--I--S--Q--T--D--L--F--G--N--P--M--M--Y--D--L--K--E--N--G--
2101   GATAAAATTCCAATTACAAATGAAAACAGGAAGGAATTTGTCAATCTTTATTCTGACTAC   2160
       D--K--I--P--I--T--N--E--N--R--K--E--F--V--N--L--Y--S--D--Y--
2161   ATTCTCAATAAATCAGTAGAAAAACAGTTCAAGGCTTTTCGGAGAGGTTTTCATATGGTG   2220
       I--L--N--K--S--V--E--K--Q--F--K--A--F--R--R--G--F--H--M--V--
2221   ACCAATGAATCTCCCTTAAAGTACTTATTCAGACCAGAAGAAATTGAATTGCTTATATGT   2280
       T--N--E--S--P--L--K--Y--L--F--R--P--E--E--I--E--L--L--I--C--
2281   GGAAGCCGGAATCTAGATTTCCAAGCACTAGAAGAAACTACAGAATATGACGGTGGCTAT   2340
       G--S--R--N--L--D--F--Q--A--L--E--E--T--T--E--Y--D--G--G--Y--
2341   ACCAGGGACTCTGTTCTGATTAGGGAGTTCTGGGAAATCGTTCATTCATTTACAGATGAA   2400
       T--R--D--S--V--L--I--R--E--F--W--E--I--V--H--S--F--T--D--E--
2401   CAGAAAAGACTCTTCTTGCAGTTTACAACGGGCACAGACAGAGCACCTGTGGGAGGACTA   2460
       Q--K--R--L--F--L--Q--F--T--T--G--T--D--R--A--P--V--G--G--L--
2461   GGAAAATTAAAGATGATTATAGCCAAAAATGGCCCAGACACAGAAAGGTTACCTACATCT   2520
       G--K--L--K--M--I--I--A--K--N--G--P--D--T--E--R--L--P--T--S--
2521   CATACTTGCTTTAATGTGCTTTTACTTCCGGAATACTCAAGCAAAGAAAAACTTAAAGAG   2580
       H--T--C--F--N--V--L--L--L--P--E--Y--S--S--K--E--K--L--K--E--
2581   AGATTGTTGAAGGCCATCACGTATGCCAAAGGATTTGGCATGCTGTAAaacaaaacaaaa   2640
       R--L--L--K--A--I--T--Y--A--K--G--F--G--M--L--***............
2641   caaaataaaacaaaaaaaaggaaggaaaaaaaaagaaaaaatttaaaaaattttaaaaat   2700
       ............................................................
2701   ataacgagggataaatttttggtggtgatagtgtcccagtacaaaaaggctgtaagatag   2760
       ............................................................
2761   tcaaccacagtagtcacctatgtctgtgcctcccttctttattggggacatgtgggctgg   2820
       ............................................................
2821   aacagcagatttcagctacatatatgaacaaatcctttattattattataattatttttt   2880
       ............................................................
2881   tgcgtgaaagtgttacatattctttcacttgtatgtacagagaggtttttctgaatattt   2940
       ............................................................
2941   attttaagggttaaatcacttttgcttgtgtttattactgcttgaggttgagccttttga   3000
       ............................................................
3001   gtatttaaaaaatatataccaacagaactactctcccaaggaaaatattgccaccatttg   3060
       ............................................................
3061   tagaccacgtaaccttcaagtatgtgctacttttttgtccctgtatctaactcaaatcag   3120
       ............................................................
3121   gaactgtattttttttaatgatttgcttttgaaacttgaagtcttgaaaacagtgtgatg   3180
       ............................................................
3181   caattactgctgttctagcccccaaagagttttctgtgcaaaatcttgagaatcaatcaa   3240
       ............................................................
3241   taaagaaagatggaaggaagggagaaattggaatgttttaactgcagccctcagaacttt   3300
       ............................................................
3301   agtaacagcacaacaaattaaaaacaaaaacaactcatgccacagtatgtcgtcttcatg   3360
       ............................................................
3361   tgtcttgcaatgaactgtttcagtagccaatcctctttcttagtatatgaaaggacaggg   3420
       ............................................................
3421   atttttgttcttgttgttctcgttgttgttttaagtttactggggaaagtgcatttggcc   3480
       ............................................................
3481   aaatgaaatggtagtcaagcctattgcaacaaagttaggaagtttgttgtttgtttatta   3540
       ............................................................
3541   taaacaaaaagcatgtgaaagtgcacttaagatagagtttttattaattacttacttatt   3600
       ............................................................
3601   acctagattttaaatagacaatccaaagtctccccttcgtgttgccatcatcttgttgaa   3660
       ............................................................
3661   tcagccattttatcgaggcacgtgatcagtgttgcaacataatgaaaaagatggctactg   3720
       ............................................................
3721   tgccttgtgttacttaatcatacagtaagctgacctggaaatgaatgaaactattactcc   3780
       ............................................................
3781   taagaattacattgtatagccccacagattaaatttaattaattaattcaaaacatgtta   3840
       ............................................................
3841   aacgttactttcatgtactatggaaaagtacaagtaggtttacattactgatttccagaa   3900
       ............................................................
3901   gtaagtagtttcccctttcctagtcttctgtgtatgtgatgttgttaatttcttttattg   3960
       ............................................................
3961   cattataaaataaaaggattatgtatttttaactaaggtgagacattgatatatcctttt   4020
       ............................................................
4021   gctacaagctatagctaatgtgctgagcttgtgccttggtgattgattgattgattgact   4080
       ............................................................
4081   gattgttttaactgattactgtagatcaacctgatgatttgtttgtttgaaattggcagg   4140
       ............................................................
4141   aaaaatgcagctttcaaatcattggggggagaaaaaggatgtctttcaggattattttaa   4200
       ............................................................
4201   ttaatttttttcataattgagacagaactgtttgttatgtaccataatgctaaataaaac   4260
       ............................................................
4261   tgtggcacttttcaccataatttaatttagtggaaaaagaagacaatgctttccatattg   4320
       ............................................................
4321   tgataaggtaacatggggtttttctgggccagcctttagaacactgttagggtacatacg   4380
       ............................................................
4381   ctaccttgatgaaagggaccttcgtgcaactgtagtcatcttaaaggcttctcatccact   4440
       ............................................................
4441   gtgcttcttaatgtgtaattaaagtgaggagaaattaaatactctgagggcgttttatat   4500
       ............................................................
4501   aataaattcgtgaaga                                               4560
       ................