Imprinted Gene Databases

Homo sapiens: TSSC4

Tumor suppressing subtransferable candidate 4
Species Gene Aliases Location Status Expressed Allele
Bos taurus TSSC4   29  Imprinted Maternal
Homo sapiens TSSC4   11p15.5  Not Imprinted Biallelic
Mus musculus Tssc4 AA241958, ESTM671070  7 69.3 cM  Imprinted Maternal
1      gttgagcagctgaacagaggccatgccggggcactccgaggcctgagacgaccacgcctg     60
       ............................................................
61     tgccgctgaggaccttcatcagggctccgtccacttggcccgcttggctgtccaatcaca    120
       ............................................................
121    ctccagtgtcaaccactggcacccagcagccaagagaggtgtggcgtggccctggggacg    180
       ............................................................
181    cATGGCTGAGGCAGGAACAGGTGAGCCGTCCCCCAGCGTGGAGGGCGAACACGGGACGGA    240
       .M--A--E--A--G--T--G--E--P--S--P--S--V--E--G--E--H--G--T--E-
241    GTATGACACGCTGCCTTCCGACACAGTCTCCCTCAGTGACTCGGACTCTGACCTCAGCTT    300
       -Y--D--T--L--P--S--D--T--V--S--L--S--D--S--D--S--D--L--S--L-
301    GCCCGGTGGTGCTGAAGTGGAAGCACTGTCCCCGATGGGGCTGCCTGGGGAGGAGGATTC    360
       -P--G--G--A--E--V--E--A--L--S--P--M--G--L--P--G--E--E--D--S-
361    AGGTCCTGATGAGCCGCCCTCACCCCCGTCAGGCCTCCTCCCAGCCACGGTGCAGCCATT    420
       -G--P--D--E--P--P--S--P--P--S--G--L--L--P--A--T--V--Q--P--F-
421    CCATCTGAGAGGCATGAGCTCCACCTTCTCCCAGCGCAGCCGTGACATCTTTGACTGCCT    480
       -H--L--R--G--M--S--S--T--F--S--Q--R--S--R--D--I--F--D--C--L-
481    GGAGGGGGCGGCCAGACGGGCTCCATCCTCTGTGGCCCACACCAGCATGAGTGACAACGG    540
       -E--G--A--A--R--R--A--P--S--S--V--A--H--T--S--M--S--D--N--G-
541    AGGCTTCAAGCGGCCCCTAGCGCCCTCAGGCCGGTCTCCAGTGGAAGGCCTGGGCAGGGC    600
       -G--F--K--R--P--L--A--P--S--G--R--S--P--V--E--G--L--G--R--A-
601    CCATCGGAGCCCTGCCTCACCAAGGGTGCCTCCGGTCCCCGACTACGTGGCACACCCCGA    660
       -H--R--S--P--A--S--P--R--V--P--P--V--P--D--Y--V--A--H--P--E-
661    GCGCTGGACCAAGTACAGCCTGGAAGATGTGACCGAGGTCAGCGAGCAGAGCAATCAGGC    720
       -R--W--T--K--Y--S--L--E--D--V--T--E--V--S--E--Q--S--N--Q--A-
721    CACCGCCCTGGCCTTCCTGGGCTCCCAGAGCCTGGCTGCCCCCACTGACTGCGTGTCCTC    780
       -T--A--L--A--F--L--G--S--Q--S--L--A--A--P--T--D--C--V--S--S-
781    CTTCAACCAGGATCCCTCCAGCTGTGGGGAGGGGAGGGTCATCTTCACCAAACCAGTCCG    840
       -F--N--Q--D--P--S--S--C--G--E--G--R--V--I--F--T--K--P--V--R-
841    AGGGGTCGAAGCCAGACACGAGAGGAAGAGGGTCCTGGGGAAGGTGGGAGAGCCAGGCAG    900
       -G--V--E--A--R--H--E--R--K--R--V--L--G--K--V--G--E--P--G--R-
901    GGGCGGCCTTGGGAATCCTGCCACAGACAGGGGCGAGGGCCCTGTGGAGCTGGCCCATCT    960
       -G--G--L--G--N--P--A--T--D--R--G--E--G--P--V--E--L--A--H--L-
961    GGCCGGGCCCGGGAGCCCAGAGGCTGAGGAGTGGGGCAGCCACCATGGAGGCCTGCAGGA   1020
       -A--G--P--G--S--P--E--A--E--E--W--G--S--H--H--G--G--L--Q--E-
1021   GGTGGAGGCACTGTCAGGGTCTGTCCACAGTGGGTCTGTGCCAGGTCTCCCGCCGGTGGA   1080
       -V--E--A--L--S--G--S--V--H--S--G--S--V--P--G--L--P--P--V--E-
1081   AACTGTTGGCTTCCATGGCAGCAGGAAGCGGAGTCGAGACCACTTCCGGAACAAGAGCAG   1140
       -T--V--G--F--H--G--S--R--K--R--S--R--D--H--F--R--N--K--S--S-
1141   CAGCCCCGAGGACCCAGGTGCTGAGGTCTGAgagggagatggcccagcctgaccccactg   1200
       -S--P--E--D--P--G--A--E--V--***.............................
1201   gccactgccatcctgctgccttcccagtggggctggtcagggggcagcctggccactgcc   1260
       ............................................................
1261   tagctggaatgggaggaagcctgcaggtggcaccggtggccctggctgcagttctgggca   1320
       ............................................................
1321   gcatcctcccaagcagagaccttgctgaagctcctggggtgtggggtgtgggctggaagc   1380
       ............................................................
1381   actggctccctggtagggacaataaaggttttgggtctttctgaaaaaaaaaaaaaaaaa   1440
       ............................................................
1441   aaa                                                            1500
       ...