Imprinted Gene Databases

Homo sapiens: SLC22A18

Solute carrier family 22, member 18
Species Gene Aliases Location Status Expressed Allele
Homo sapiens SLC22A18 HET, ITM, BWR1A, IMPT1, TSSC5, ORCTL2, BWSCR1A, SLC22A1L, p45-BWR1A, DKFZp667A184  11p15.5  Imprinted Maternal
Mus musculus Slc22a18 HET, ITM, BWR1A, Impt1, TSSC5, Orctl2, BWSCR1A, AW260131, Slc22a1l, p45-BWR1A  7 69.5 cM  Imprinted Maternal
1      atcccggaaggaccggtgtctaggtcaccctggagcgctcaccccaccggcacccgtgcc     60
       ............................................................
61     caagcccgcccctgcaaaggcaggcaaggccaggcgggtgctgcctgggacccagtgact    120
       ............................................................
121    cagcacccctgcccggatcaactggacttttgccccctgctccgccagcctcctgcttgg    180
       ............................................................
181    atctctcctgggtctccctgctgcgcctgtccaggATGCAGGGAGCTCGGGCTCCCAGGG    240
       ...................................M--Q--G--A--R--A--P--R--D
241    ACCAGGGCCGGTCCCCCGGCAGGATGAGCGCTCTAGGCCGGTCCTCGGTCATCTTGCTTA    300
       --Q--G--R--S--P--G--R--M--S--A--L--G--R--S--S--V--I--L--L--T
301    CCTACGTGCTGGCCGCCACAGAACTTACCTGCCTCTTCATGCAGTTCTCCATCGTGCCAT    360
       --Y--V--L--A--A--T--E--L--T--C--L--F--M--Q--F--S--I--V--P--Y
361    ACCTGTCTCGGAAACTGGGCCTGGATTCCATTGCCTTCGGCTACCTGCAAACCACCTTCG    420
       --L--S--R--K--L--G--L--D--S--I--A--F--G--Y--L--Q--T--T--F--G
421    GGGTGCTGCAGCTGCTGGGCGGGCCGGTATTTGGCAGGTTCGCAGACCAGCGCGGGGCGC    480
       --V--L--Q--L--L--G--G--P--V--F--G--R--F--A--D--Q--R--G--A--R
481    GGGCGGCGCTCACGCTCTCCTTCCTGGCTGCCTTGGCGCTCTACCTGCTCCTGGCGGCCG    540
       --A--A--L--T--L--S--F--L--A--A--L--A--L--Y--L--L--L--A--A--A
541    CCTCCAGCCCGGCCCTGCCCGGGGTCTACCTGCTCTTCGCCTCGCGCCTGCCCGGAGCGC    600
       --S--S--P--A--L--P--G--V--Y--L--L--F--A--S--R--L--P--G--A--L
601    TCATGCACACGCTGCCAGCCGCCCAGATGGTCATCACGGACCTGTCGGCACCCGAGGAGC    660
       --M--H--T--L--P--A--A--Q--M--V--I--T--D--L--S--A--P--E--E--R
661    GGCCCGCGGCCCTGGGCCGGCTGGGCCTCTGCTTCGGCGTCGGAGTCATCCTCGGCTCCC    720
       --P--A--A--L--G--R--L--G--L--C--F--G--V--G--V--I--L--G--S--L
721    TGCTGGGCGGGACCCTGGTCTCCGCGTACGGGATTCAGTGCCCGGCCATCCTGGCTGCCC    780
       --L--G--G--T--L--V--S--A--Y--G--I--Q--C--P--A--I--L--A--A--L
781    TGGCCACCCTCCTGGGAGCTGTCCTCAGCTTCACCTGCATCCCCGCCAGCACCAAAGGGG    840
       --A--T--L--L--G--A--V--L--S--F--T--C--I--P--A--S--T--K--G--A
841    CCAAAACTGACGCCCAGGCTCCACTGCCAGGCGGCCCCCGGGCCAGTGTGTTCGACCTGA    900
       --K--T--D--A--Q--A--P--L--P--G--G--P--R--A--S--V--F--D--L--K
901    AGGCCATCGCCTCCCTGCTGCGGCTGCCAGACGTCCCGAGGATCTTCCTGGTGAAGGTGG    960
       --A--I--A--S--L--L--R--L--P--D--V--P--R--I--F--L--V--K--V--A
961    CCTCCAACTGCCCCACAGGGCTCTTCATGGTCATGTTCTCCATCATCTCCATGGACTTCT   1020
       --S--N--C--P--T--G--L--F--M--V--M--F--S--I--I--S--M--D--F--F
1021   TCCAGCTGGAGGCCGCCCAAGCTGGCTACCTCATGTCCTTCTTCGGGCTCCTCCAGATGG   1080
       --Q--L--E--A--A--Q--A--G--Y--L--M--S--F--F--G--L--L--Q--M--V
1081   TGACCCAGGGCCTGGTCATCGGGCAGCTGAGCAGCCACTTCTCGGAGGAGGTGCTGCTCC   1140
       --T--Q--G--L--V--I--G--Q--L--S--S--H--F--S--E--E--V--L--L--R
1141   GGGCCAGCGTGCTGGTCTTCATCGTGGTGGGCCTGGCCATGGCCTGGATGTCCAGCGTCT   1200
       --A--S--V--L--V--F--I--V--V--G--L--A--M--A--W--M--S--S--V--F
1201   TCCACTTCTGCCTCCTGGTGCCCGGCCTGGTGTTCAGCCTCTGCACCCTCAACGTGGTCA   1260
       --H--F--C--L--L--V--P--G--L--V--F--S--L--C--T--L--N--V--V--T
1261   CCGACAGCATGCTGATCAAGGCTGTCTCCACCTCGGACACAGGGACCATGCTGGGCCTCT   1320
       --D--S--M--L--I--K--A--V--S--T--S--D--T--G--T--M--L--G--L--C
1321   GCGCCTCTGTACAACCACTGCTCCGAACTCTGGGACCCACGGTCGGCGGCCTCCTGTACC   1380
       --A--S--V--Q--P--L--L--R--T--L--G--P--T--V--G--G--L--L--Y--R
1381   GCAGCTTTGGCGTCCCCGTCTTCGGCCACGTGCAGGTTGCTATCAATACCCTTGTCCTCC   1440
       --S--F--G--V--P--V--F--G--H--V--Q--V--A--I--N--T--L--V--L--L
1441   TGGTCCTCTGGAGGAAACCTATGCCCCAGAGGAAGGACAAAGTCCGGTGAccgctgccca   1500
       --V--L--W--R--K--P--M--P--Q--R--K--D--K--V--R--***..........
1501   gacacagactggcaataaactcctactaaatccctccgaaaaaaaaaaaaaaaaa        1560
       .......................................................