Imprinted Gene Databases

Homo sapiens: PON2

Paraoxonase 2
Species Gene Aliases Location Status Expressed Allele
Sus scrofa PON2   Imprinted Maternal
Homo sapiens PON2   7q21.3  Not Imprinted Biallelic
Mus musculus Pon2 AI481612, MGC68232, 6330405I24Rik  6 A1  Provisional Data Maternal
1      ggactcggcctaggcggaggacggggcggagcgcggccggcaccatcgagccgggaagat     60
       ............................................................
61     ggcaccgcccacggagctgctggccaggccggagcgaggcagcgcgcccggctcccgcgc    120
       ............................................................
121    cATGGGGCGGCTGGTGGCTGTGGGCTTGCTGGGGATCGCGCTGGCGCTCCTGGGCGAGAG    180
       .M--G--R--L--V--A--V--G--L--L--G--I--A--L--A--L--L--G--E--R-
181    GCTTCTGGCACTCAGAAATCGACTTAAAGCCTCCAGAGAAGTAGAATCTGTAGACCTTCC    240
       -L--L--A--L--R--N--R--L--K--A--S--R--E--V--E--S--V--D--L--P-
241    ACACTGCCACCTGATTAAAGGAATTGAAGCTGGCTCTGAAGATATTGACATACTTCCCAA    300
       -H--C--H--L--I--K--G--I--E--A--G--S--E--D--I--D--I--L--P--N-
301    TGGTCTGGCTTTTTTTAGTGTGGGTCTAAAATTCCCAGGACTCCACAGCTTTGCACCAGA    360
       -G--L--A--F--F--S--V--G--L--K--F--P--G--L--H--S--F--A--P--D-
361    TAAGCCTGGAGGAATACTAATGATGGATCTAAAAGAAGAAAAACCAAGGGCACGGGAATT    420
       -K--P--G--G--I--L--M--M--D--L--K--E--E--K--P--R--A--R--E--L-
421    AAGAATCAGTCGTGGGTTTGATTTGGCCTCATTCAATCCACATGGCATCAGCACTTTCAT    480
       -R--I--S--R--G--F--D--L--A--S--F--N--P--H--G--I--S--T--F--I-
481    AGACAACGATGACACAGTTTATCTCTTTGTTGTAAACCACCCAGAATTCAAGAATACAGT    540
       -D--N--D--D--T--V--Y--L--F--V--V--N--H--P--E--F--K--N--T--V-
541    GGAAATTTTTAAATTTGAAGAAGCAGAAAATTCTCTGTTGCATCTGAAAACAGTCAAACA    600
       -E--I--F--K--F--E--E--A--E--N--S--L--L--H--L--K--T--V--K--H-
601    TGAGCTTCTTCCAAGTGTGAATGACATCACAGCTGTTGGACCGGCACATTTCTATGCCAC    660
       -E--L--L--P--S--V--N--D--I--T--A--V--G--P--A--H--F--Y--A--T-
661    AAATGACCACTACTTCTCTGATCCTTTCTTAAAGTATTTAGAAACATACTTGAACTTACA    720
       -N--D--H--Y--F--S--D--P--F--L--K--Y--L--E--T--Y--L--N--L--H-
721    CTGGGCAAATGTTGTTTACTACAGTCCAAATGAAGTTAAAGTGGTAGCAGAAGGATTTGA    780
       -W--A--N--V--V--Y--Y--S--P--N--E--V--K--V--V--A--E--G--F--D-
781    TTCAGCAAATGGGATCAATATTTCACCTGATGATAAGTATATCTATGTTGCTGACATATT    840
       -S--A--N--G--I--N--I--S--P--D--D--K--Y--I--Y--V--A--D--I--L-
841    GGCTCATGAAATTCATGTTTTGGAAAAACACACTAATATGAATTTAACTCAGTTGAAGGT    900
       -A--H--E--I--H--V--L--E--K--H--T--N--M--N--L--T--Q--L--K--V-
901    ACTTGAGCTGGATACACTGGTGGATAATTTATCTATTGATCCTTCCTCGGGGGACATCTG    960
       -L--E--L--D--T--L--V--D--N--L--S--I--D--P--S--S--G--D--I--W-
961    GGTAGGCTGTCATCCTAATGGCCAGAAGCTCTTCGTGTATGACCCGAACAATCCTCCCTC   1020
       -V--G--C--H--P--N--G--Q--K--L--F--V--Y--D--P--N--N--P--P--S-
1021   GTCAGAGGTTCTCCGCATCCAGAACATTCTATCTGAGAAGCCTACAGTGACTACAGTTTA   1080
       -S--E--V--L--R--I--Q--N--I--L--S--E--K--P--T--V--T--T--V--Y-
1081   TGCCAACAATGGGTCTGTTCTCCAAGGAAGTTCTGTAGCCTCAGTGTATGATGGGAAGCT   1140
       -A--N--N--G--S--V--L--Q--G--S--S--V--A--S--V--Y--D--G--K--L-
1141   GCTCATAGGCACTTTATACCACAGAGCCTTGTATTGTGAACTCTAAattgtacttttggc   1200
       -L--I--G--T--L--Y--H--R--A--L--Y--C--E--L--***..............
1201   atgaaagtgcgataacttaacaattaattttctatgaattgctaattctgagggaattta   1260
       ............................................................
1261   accagcaacattgacccagaaatgtatggcatgtgtagttaattttattccagtaaggaa   1320
       ............................................................
1321   cggcccttttagttcttagagcacttttaacaaaaaaggaaaatgaacaggttctttaaa   1380
       ............................................................
1381   atgccaagcaagggacagaaaagaaagctgctttcgaataaagtgaatacattttgcaca   1440
       ............................................................
1441   aagtaagcctcacctttgccttccaactgccagaacatggattccactgaaatagagtga   1500
       ............................................................
1501   attatatttccttaaaatgtgagtgacctcacttctggcactgtgactactatggctgtt   1560
       ............................................................
1561   tagaactactgataacgtattttgatgttttgtacttacatctttgtttaccattaaaaa   1620
       ............................................................
1621   gttggagttatattaaagactaactaaaatcccaaaaaaaaaaaaaaaa              1680
       .................................................