Imprinted Gene Databases

Homo sapiens: PEG3

Paternally expressed gene 3

Murphy et al., Genomics 71: 110-117, 2001

Species Gene Aliases Location Status Expressed Allele
Ovis aries PEG3   18  Imprinted Paternal
Macaca mulatta PEG3   19  Imprinted
Bos taurus PEG3   18  Imprinted Paternal
Homo sapiens PEG3 PW1, ZNF904, ZSCAN24  19q13.4  Imprinted Paternal
Sus scrofa PEG3   6q11-q22  Imprinted Paternal
Mus musculus Peg3 Pw1, End4, Gcap4, Zfp102, AL022617, mKIAA0287  7 6.5 cM  Imprinted Paternal
1      gcagaagtctgggcagctgcgggaggagaggtttgggaggcgcgggagatgtccaccctg     60
61     ggctggtggcgccgccgggcgccgggcgccatgagggtgcgctaggcggctgttcgtgcc    120
121    cgaggctgcgcagcactgaggtgagctttgccttcttgatcttccgtccttcttggagac    180
181    gactggcgagaggaagagggactaggtccaaacgctaggtggctgggtccagatacctgt    240
241    gttttgactctgttcctgtggatagctgcttggtctgaagttccagaaaggatcctgttc    300
301    ccagacaggtccctgagtactgacggtcacaggctgccgcgtctttcctgttgactcatg    360
361    tttggttcctccagtgaaaattttacttagagaaATGCTGCCTCCAAAGCACTTGTCTGC    420
5161   Agggcatggggtaaaggttagaaaaccttcacctaggacttgacccttaccaaaccacag   5220
5221   agaatccaaaccaatccatgataatgtcagtaggagacttaaccttagtgtgttacacac   5280
5281   ctgacttaacatctctaaactcagattgaaaagagaccgaatgtgcagattccacagtct   5340
5341   taagctttccccttcagatgtcagtgtctgcatgtgggaaagccatagcacacatcttac   5400
5401   ctttccaagtaatcagattgagaaaaccctatgagtattccagactacagagtttgccca   5460
5461   aatcaactgtaaatgacacttgtgtaacgtatatatagtgtttcatgaggtgtatataaa   5520
5521   atagcaaattatgacagaacagtgatcacatatatttggatttatatgatatacagttac   5580
5581   agtttactctgcagaggtaccttacctggtattctttgaattttttttttttttggagga   5640
5641   ggaagagagcaacaaatttgattatatttttaagtgtcttagatcctgagaaagatttat   5700
5701   tgtgcattatttgaaccctgtcaatatctttttgagtaattgttttgtttcttaccctta   5760
5761   aatagtcttgtgaagctgtaggcatgatagataacatggcttttactccttactgtttga   5820
5821   aaagataagtactttagcttctttctgcagccatttcatctgcgccaacactttggaacc   5880
5881   taatactgtgtaaggctttacaatatacggattggctttttgtgacccagattgattggt   5940
5941   tgccacatgttatgtttgttgaagtggttctcatgcaaaaatattacacatttgtgttct   6000
6001   gggttttttttttttttaaccaactcaatatgtgtttgatgatagtgaattgataaaacc   6060
6061   cgaagcttttccctgtaaatcttacatctttgcctttaaagaatgggttacaaccatcac   6120
6121   tagatcacagtagtgcctaatgaaggttgagaaccgtaggagaggctctcatgctgtaaa   6180
6181   taatgttgcaggctaataacctttcatcacttcctttgtgcgcttcctgccttaagtgac   6240
6241   aagtagcaacatggcttgggtcccctgtgcagcatcagcttatgctgccacaagtcagtt   6300
6301   tgcaccctaggtgcccaggagctagtatccttagatctttctatcgctaacttaattctc   6360
6361   ttcgttatttatctgaccctctaactccatgtctaacttgcattaaaaaaaaaaaaattc   6420
6421   tttacagtcaacccaagcttaacatggactcaggttccccagcagccttaatttgttttg   6480
6481   ttaacatctgttccttctttttcagctctcctagagtatttctgagtgttgtgttcatct   6540
6541   aatcttagtattcttttaattacaaattgacctcacagcttgaggtttcttgtgtcctat   6600
6601   tctgtggactacctgtgctcctttgcttcccctcccctcgcataataactatattaagaa   6660
6661   attttttttggccttgagttggctggaaaaaaaatataaaatttaaaaaatttaaaaaaa   6720
6721   aagatttgcaaaatgtaagtgtagatcatttgaacaagcaaaattaaagtacccactggg   6780
6781   ggaaatgtgtctgaatcttactcttctggatctgcaggattagggcttggaagtatgtca   6840
6841   aagatgcagggagtgtcaaagtttaggaagattgtagagctgagagcaagaagcagaaat   6900
6901   gagtgagtcaaagaagggagtcctaatatatcaccagatctaggaggggagaggagacag   6960
6961   acagaagaaaacaccagaggcaagaactgtagaaggccaggtttctgagaatgaattgag   7020
7021   cggggtgtcctgagcagtttggaaaaggagtttttgatggtatggtgtaggtgagggctg   7080
7081   gctgcataggaaggactgaggttggaacggacatcgggaaagctgaggggcagtgaggtt   7140
7141   tactacatgggaaaaggactcttgaaacgagaatcagtgttgatgtcggggtgaactttg   7200
7201   tgggtacattacttggtgttaacattgttggcagtggtagccccttttcagaaagcaact   7260
7261   tgctgtaagtcagggtgtccgttccaaccttcagctagtgaaaaggtagtaacaaatggt   7320
7321   aaacaagagaatgattgtttaaacctatctgtggacacttaatgcaactgtttaaaaatg   7380
7381   ataatcacgagttatgtagcaacgtggaaatatatttacagaacattaagtggagaaagc   7440
7441   aggacacgaaagtatatttatactacagttataactcaacagttcatttatatgctgttc   7500
7501   atttaacagttcatttaaacagttcattataactgtttaaaaatatatatgcttatagtc   7560
7561   aaaagctgttgtggtgttgttgttgtaggcttatagttgagcattattttcttaaatttc   7620
7621   ttgaatgttctttatggtagtgttactaaaaagtttatgatcacattttcattgtgaaca   7680
7681   taatttgaactcattatcacacacttggaaaatacagaaaagtggaggaaaaaaaatcat   7740
7741   atccccaccatccaaagacatatactctcctcttatcttgttcattcttgtttctgtgca   7800
7801   caggtttatgattataactgtgtcaaaatgtatattcaaaatagctgttacattaccttt   7860
7861   gtggaattatggttaaatactttcactttaattttttcaaatgttccctataataatgtc   7920
7921   ctgataacagtgtattatgtgtgtctccattggtgtgcataatacatacccagaggaaaa   7980
7981   attagaaaataaagtaaattattttaaaaaattacctatattcccaacacctaacaacta   8040
8041   ctgctaacatcttgatctgtttcctctatcttgtttcagtgcacacgcttgtgataacag   8100
8101   tgttaaatatgtgtgcataaagtcttaaatgaaaagatgtggaaaataactaaaatagtg   8160
8161   ttgtcattgtgggaatttggttaaatattttgtctcaaattccttaaataatctttggtg   8220
8221   ttttggtaataaattttatgtatgtattttccattacaaatataatacatactcatacaa   8280
8281   aactttggaaattcagtaaagaaaattcacacatattcccaacacccaacaacaattaac   8340
8341   tgttaacatcttgatctgtgcactagtctgtgattattagggtgttagtgataagtatgc   8400
8401   ataaatgtcaaagatgggaagaaagatgaaaaacaagaaatagttgtgtggttgttgtgg   8460
8461   gattatggttattttgtttcggtttccttgaaaggtcatcattctagtgttttggtagtc   8520
8521   cacctttactacatatatttccattatatatgaaatgtgttcattatagaaactttgaag   8580
8581   ttacagaaatgtagaagagaaactcacccatgttttcaccatccaaagagtgtggttaac   8640
8641   atcttgatatattttcttcatcttgtttctgtgcacaggtttttggtttgttaatatggt   8700
8701   tgtggtcattctatctgtaatagtgtcaacaataaaaataaagttaaaaataaatattta   8760
8761   aaaaa                                                          8820