Imprinted Gene Databases

Homo sapiens: NAA60

N(alpha)-acetyltransferase 60, NatF catalytic subunit

Nakabayashi K et al., Hum Mol Genet 20: 3188-3197, 2011, Morcos L et al., Genome Biol 12: R25, 2011

Species Gene Aliases Location Status Expressed Allele
Homo sapiens NAA60 HAT4, NAT15  16p13.3  Imprinted Maternal
1      ttccgggctgcgctgccggcagggagcgggaggcggaagtgccgcgggctgccgcctccg     60
       ............................................................
61     tcccggctgcggcccctgccggttacataactcgttgcgggctccgcgcggtcccacttc    120
       ............................................................
121    ccggctcccttcgcctccaggatgcgctgagccctacaacacccccagcggccgccggct    180
       ............................................................
181    cccccacgaggtgtgaATGACAGAGGTGGTGCCATCCAGCGCGCTCAGCGAGGTCAGCCT    240
       ................M--T--E--V--V--P--S--S--A--L--S--E--V--S--L-
241    GCGCCTCCTCTGCCACGATGACATAGACACTGTGAAGCACCTGTGTGGCGACTGGTTCCC    300
       -R--L--L--C--H--D--D--I--D--T--V--K--H--L--C--G--D--W--F--P-
301    CATCGAGTACCCAGACTCATGGTATCGTGATATCACATCCAACAAGAAGTTCTTTTCCCT    360
       -I--E--Y--P--D--S--W--Y--R--D--I--T--S--N--K--K--F--F--S--L-
361    TGCTGCAACCTACAGAGGTGCCATTGTGGGAATGATAGTAGCTGAAATTAAGAACAGGAC    420
       -A--A--T--Y--R--G--A--I--V--G--M--I--V--A--E--I--K--N--R--T-
421    CAAAATACATAAAGAGGATGGAGATATTCTAGCATCCAACTTCTCTGTTGACACACAAGT    480
       -K--I--H--K--E--D--G--D--I--L--A--S--N--F--S--V--D--T--Q--V-
481    CGCGTACATCCTAAGTCTGGGCGTCGTGAAAGAGTTCAGGAAGCACGGCATAGGTTCCCT    540
       -A--Y--I--L--S--L--G--V--V--K--E--F--R--K--H--G--I--G--S--L-
541    CTTACTTGAAAGTTTAAAGGATCACATATCAACCACCGCCCAGGACCACTGCAAAGCCAT    600
       -L--L--E--S--L--K--D--H--I--S--T--T--A--Q--D--H--C--K--A--I-
601    TTACCTGCATGTCCTCACCACCAACAACACAGCAATAAACTTCTATGAAAACAGAGACTT    660
       -Y--L--H--V--L--T--T--N--N--T--A--I--N--F--Y--E--N--R--D--F-
661    CAAGCAGCACCACTATCTCCCCTATTACTACTCCATTCGAGGGGTCCTCAAAGATGGCTT    720
       -K--Q--H--H--Y--L--P--Y--Y--Y--S--I--R--G--V--L--K--D--G--F-
721    CACCTATGTCCTCTACATCAACGGCGGCCACCCTCCCTGGACGATTTTGGACTACATCCA    780
       -T--Y--V--L--Y--I--N--G--G--H--P--P--W--T--I--L--D--Y--I--Q-
781    GCACCTGGGCTCTGCACTAGCCAGCCTGAGCCCCTGCTCCATTCCGCACAGAGTCTACCG    840
       -H--L--G--S--A--L--A--S--L--S--P--C--S--I--P--H--R--V--Y--R-
841    CCAGGCCCACAGCCTGCTCTGCAGCTTCCTGCCATGGTCGGGCATCTCTTCCAAGAGTGG    900
       -Q--A--H--S--L--L--C--S--F--L--P--W--S--G--I--S--S--K--S--G-
901    CATCGAGTACAGCCGGACCATGTGAtgtcggctgggcagccgccaccaggccccaccctt    960
       -I--E--Y--S--R--T--M--***...................................
961    cggccgcccgcagagcccgccttcctgtccatctgaccccttctgttttctgcaaggagc   1020
       ............................................................
1021   tgccagccatctaactgggctcgtcggcctgccccagctgcaggcccggtgctacacggg   1080
       ............................................................
1081   ctcgggaacagaacatcgtgggcatgcgcagagcatgcccatccgtggcaggtacgccac   1140
       ............................................................
1141   agcagacacaaaggctcttcagctcccctccctgcttctggaaacctctgcctgctgccc   1200
       ............................................................
1201   tggccctgcccccctgcgcatgcaccgtccccagggctgacccagtgtggctgcattcac   1260
       ............................................................
1261   tgggaggggcctgccctcactgggcctctcccactccgctgcctgttcttgcagctcctt   1320
       ............................................................
1321   cctggaaagctggaggggactttctcctgcaagggaggaacgcaagtattatggacacac   1380
       ............................................................
1381   ttgaccgtaaaggcacaggagcctcggaacaagggggcgcaataaagggaatggcccgtc   1440
       ............................................................
1441   cccttccagaaccagcccaaagaagcctggggggtgaggagtggcccccactcctccatg   1500
       ............................................................
1501   aggggctgatgaggggtgggcagcctgggggaggctttcctcgcaagcacagagctctga   1560
       ............................................................
1561   ggctcagccccctggcacaggcggtcacgcatcaggacggttcctactcctcagcacctt   1620
       ............................................................
1621   ccgtgcagttaccagtgccctgggaggtcacactgcccgtcggaccttggcatgctccat   1680
       ............................................................
1681   tcagctgacctgctgaggacaggcatcgccgagactccttgggtcctccccgccctccct   1740
       ............................................................
1741   catgctgccacaagctgctgctccaaggcctggccacatgcagacaggaggaagctgagc   1800
       ............................................................
1801   tcgacattaggcctcaaggctgccatctgtcttgtagggcctggccttgtgggcaggggg   1860
       ............................................................
1861   cagtcctgtgccttgtgggccctcagcctctgagggcagagatgctgtcagtgccgcagg   1920
       ............................................................
1921   tgcatcacatacttctagcatcctctccaccctgcattccaaatgctgcttgctgcctgc   1980
       ............................................................
1981   cctgccctccgatgcaggggtggggtggggggcggagtcccgcccagcatagctgcagtg   2040
       ............................................................
2041   tcacaaagccatggcagagggtcctagcggcgccaccctgccccagcctgaggaggaggg   2100
       ............................................................
2101   agagggaggaacaaccctgggcagacggggcctcagggacctgtgtccttccgcctccag   2160
       ............................................................
2161   agctgcccagccacgggctctcagggtgctggggcagccccaggtcccctcttgaactca   2220
       ............................................................
2221   gctggggccaggggccctcagaatgaaggcaggcaccaggcaggagcagcatccccctcc   2280
       ............................................................
2281   ttgacggtgctggcaggagggccgcgccatgctgactgcttgaacctctgctgacctgac   2340
       ............................................................
2341   agtgctggcgggagggccgcaccatgctgactgcctgaatctctgctgaggctgcctgcc   2400
       ............................................................
2401   tgccgggcccagctcagcgccctctccactgcgaatcagtggcgatcatgtgatttctat   2460
       ............................................................
2461   ttctgccccacagggtaagggacgagtcttctggaaggctctgccatggacatttgtcct   2520
       ............................................................
2521   cgggctcagaggccccaccctgccccacacctgcccctgatcactgcagtgtccagccca   2580
       ............................................................
2581   gtgttgaacagattgtagcgttctgtctcattacgagcaaataaatagactttcattgga   2640
       ............................................................
2641   gttcgtcacaaaaaaaaaaaaaaa                                       2700
       ........................