Imprinted Gene Databases

Homo sapiens: MKRN3

Makorin ring finger protein 3
Species Gene Aliases Location Status Expressed Allele
Mus musculus Mkrn3 Zfp127, D7H15S9-1  7 29.0 cM  Imprinted Paternal
Macaca mulatta MKRN3   Imprinted Paternal
Homo sapiens MKRN3 D15S9, RNF63, ZFP127, ZNF127, MGC88288  15q11-q13  Imprinted Paternal
1      tgtttcagaatctataggattatattttttttaaggcagacagatacgaaaatacaacga     60
61     agcgtgcatgaccgaaaccagaagagattaaagtaaaacctcattctcctgaggaaatcg    120
121    tgtgagaagggacttagggactgccggaacacagcgaagcagaggcagaaggcagacaaa    180
181    aggggctgggttggtccccgcctgtgtgaacgaaaaaatatgtcagattggaaaattgcg    240
241    gtaaaaaccaggcagagcacgtacgttgcccccacaggaagtgtccgccatgctgcctgt    300
301    gcccggaagtaggtaggaacacacagtcagagggacccaaaagcaggggggaaggaaaaa    360
361    gagatgcacacttcccccagagaagcctccgagcgcggccgccattccgggcctcaagcc    420
421    cataaagaaaaaataccggagaggttctggcaccatttcggggtgccaaagcagccATGG    480
1981   ATTTCAATTTGATTCTGTAGcatcgtgctgtggcatgtggtctagtctgctgaggttctg   2040
2041   tcgtctgctattgcctgttttccctgtgttgacactcttactgctttcaggggctgttga   2100
2101   ggcagtgcttctgttttcttgtctattctgcatatctttccccctaggattatggtgatt   2160
2161   atctgtgttaaaaaataagtccttaaagttactgttttggtgaaattaatattaatgtca   2220
2221   gcttatggcttttttttgtcatctctgttgtcaacaggattaactcagttctagtgtagt   2280
2281   gtttactgaatttccacacttattttgaagaccctcaagagtaaatgtggcagagtgaaa   2340
2341   ggagaagttttaattgaactagtagctttgtgctataatagccttaacaaatggaccctt   2400
2401   gcagggctttgcagctgctcatctgtttgtttacagtttgttctttccctccttcccctt   2460
2461   caagtgcacttgttaaactgtgatgaacttgtgattttgtgttttacttgaccaaaacca   2520
2521   agtgtatatgtttacatgtttttatcctgtttagcttgacatgaaataatttatatttgg   2580
2581   aaatatatatttaagaattatatatataaaaatatatatgtataagagttatgtatttga   2640
2641   aaaaaatatataaaagaatatacatcacaatataatatttatgtttatgtaataaagtaa   2700
2701   atacagagctgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa                   2760