Imprinted Gene Databases

Homo sapiens: MKRN3

Makorin ring finger protein 3
Species Gene Aliases Location Status Expressed Allele
Mus musculus Mkrn3 Zfp127, D7H15S9-1  7 29.0 cM  Imprinted Paternal
Homo sapiens MKRN3 D15S9, RNF63, ZFP127, ZNF127, MGC88288  15q11-q13  Imprinted Paternal
Macaca mulatta MKRN3   Imprinted Paternal
1      tgtttcagaatctataggattatattttttttaaggcagacagatacgaaaatacaacga     60
       ............................................................
61     agcgtgcatgaccgaaaccagaagagattaaagtaaaacctcattctcctgaggaaatcg    120
       ............................................................
121    tgtgagaagggacttagggactgccggaacacagcgaagcagaggcagaaggcagacaaa    180
       ............................................................
181    aggggctgggttggtccccgcctgtgtgaacgaaaaaatatgtcagattggaaaattgcg    240
       ............................................................
241    gtaaaaaccaggcagagcacgtacgttgcccccacaggaagtgtccgccatgctgcctgt    300
       ............................................................
301    gcccggaagtaggtaggaacacacagtcagagggacccaaaagcaggggggaaggaaaaa    360
       ............................................................
361    gagatgcacacttcccccagagaagcctccgagcgcggccgccattccgggcctcaagcc    420
       ............................................................
421    cataaagaaaaaataccggagaggttctggcaccatttcggggtgccaaagcagccATGG    480
       ........................................................M--E
481    AAGAGCCTGCAGCTCCCTCAGAAGCCCACGAGGCAGCCGGGGCCCAGGCAGGTGCTGAGG    540
       --E--P--A--A--P--S--E--A--H--E--A--A--G--A--Q--A--G--A--E--A
541    CAGCAAGGGAGGGTGTGTCTGGGCCGGACCTTCCCGTCTGTGAGCCCTCCGGGGAATCTG    600
       --A--R--E--G--V--S--G--P--D--L--P--V--C--E--P--S--G--E--S--A
601    CTGCTCCAGATTCAGCCCTGCCACATGCGGCAAGGGGCTGGGCCCCCTTCCCTGTAGCTC    660
       --A--P--D--S--A--L--P--H--A--A--R--G--W--A--P--F--P--V--A--P
661    CAGTCCCTGCCCACCTCCGCAGAGGAGGCCTGAGGCCTGCCCCAGCCTCAGGAGGAGGAG    720
       --V--P--A--H--L--R--R--G--G--L--R--P--A--P--A--S--G--G--G--A
721    CCTGGCCCAGTCCGTTGCCAAGCCGAAGCAGCGGCATTTGGACAAAGCAGATCATCTGCA    780
       --W--P--S--P--L--P--S--R--S--S--G--I--W--T--K--Q--I--I--C--R
781    GGTATTATATACATGGGCAGTGCAAGGAGGGGGAGAACTGTCGCTATTCGCACGACCTTT    840
       --Y--Y--I--H--G--Q--C--K--E--G--E--N--C--R--Y--S--H--D--L--S
841    CTGGTCGGAAGATGGCCACTGAGGGTGGCGTTTCGCCGCCTGGGGCCTCTGCAGGTGGAG    900
       --G--R--K--M--A--T--E--G--G--V--S--P--P--G--A--S--A--G--G--G
901    GCCCTAGCACGGCTGCGCACATCGAGCCCCCGACTCAGGAAGTGGCGGAAGCCCCCCCGG    960
       --P--S--T--A--A--H--I--E--P--P--T--Q--E--V--A--E--A--P--P--A
961    CTGCATCCTCCCTTTCCTTGCCTGTGATTGGCTCGGCTGCTGAAAGGGGTTTCTTTGAAG   1020
       --A--S--S--L--S--L--P--V--I--G--S--A--A--E--R--G--F--F--E--A
1021   CCGAGAGAGACAATGCAGACCGTGGAGCTGCTGGAGGAGCAGGTGTAGAAAGCTGGGCGG   1080
       --E--R--D--N--A--D--R--G--A--A--G--G--A--G--V--E--S--W--A--D
1081   ATGCCATTGAGTTTGTTCCAGGGCAGCCCTACCGGGGCCGCTGGGTTGCATCTGCCCCCG   1140
       --A--I--E--F--V--P--G--Q--P--Y--R--G--R--W--V--A--S--A--P--E
1141   AGGCTCCTCTACAGAGCTCAGAGACTGAGAGGAAGCAGATGGCTGTGGGCAGTGGGTTGC   1200
       --A--P--L--Q--S--S--E--T--E--R--K--Q--M--A--V--G--S--G--L--R
1201   GGTTTTGCTATTATGCTTCCAGGGGAGTTTGCTTTCGTGGGGAGAGCTGTATGTACCTCC   1260
       --F--C--Y--Y--A--S--R--G--V--C--F--R--G--E--S--C--M--Y--L--H
1261   ATGGAGACATATGCGACATGTGTGGGCTGCAGACCTTGCACCCCATGGATGCTGCCCAGA   1320
       --G--D--I--C--D--M--C--G--L--Q--T--L--H--P--M--D--A--A--Q--R
1321   GGGAAGAACATATGAGGGCCTGCATTGAAGCACACGAGAAAGATATGGAACTCTCGTTTG   1380
       --E--E--H--M--R--A--C--I--E--A--H--E--K--D--M--E--L--S--F--A
1381   CTGTGCAGCGTGGTATGGACAAGGTGTGTGGCATCTGCATGGAGGTTGTCTATGAGAAGG   1440
       --V--Q--R--G--M--D--K--V--C--G--I--C--M--E--V--V--Y--E--K--A
1441   CCAACCCCAATGACCGCCGCTTTGGCATTCTTTCCAATTGCAACCATTCCTTCTGTATTA   1500
       --N--P--N--D--R--R--F--G--I--L--S--N--C--N--H--S--F--C--I--R
1501   GGTGTATCCGCAGGTGGAGAAGTGCCAGACAGTTTGAGAACAGGATCGTCAAGTCTTGCC   1560
       --C--I--R--R--W--R--S--A--R--Q--F--E--N--R--I--V--K--S--C--P
1561   CACAGTGCAGGGTCACCTCTGAATTGGTCATTCCCAGTGAGTTCTGGGTGGAGGAGGAGG   1620
       --Q--C--R--V--T--S--E--L--V--I--P--S--E--F--W--V--E--E--E--E
1621   AAGAGAAGCAGAAACTTATTCAGCAATACAAGGAGGCAATGAGCAACAAGGCCTGCAGGT   1680
       --E--K--Q--K--L--I--Q--Q--Y--K--E--A--M--S--N--K--A--C--R--Y
1681   ATTTTGCGGAAGGCAGGGGTAACTGCCCATTTGGAGACACATGCTTTTACAAGCATGAAT   1740
       --F--A--E--G--R--G--N--C--P--F--G--D--T--C--F--Y--K--H--E--Y
1741   ACCCTGAGGGCTGGGGAGATGAGCCTCCTGGGCCAGGTGGTGGGTCATTCAGCGCATACT   1800
       --P--E--G--W--G--D--E--P--P--G--P--G--G--G--S--F--S--A--Y--W
1801   GGCATCAACTTGTGGAGCCTGTGCGAATGGGAGAGGGCAACATGCTCTATAAAAGCATTA   1860
       --H--Q--L--V--E--P--V--R--M--G--E--G--N--M--L--Y--K--S--I--K
1861   AGAAGGAGCTTGTCGTGCTTCGGCTGGCCAGTCTGTTGTTTAAGCGGTTTCTTTCACTGA   1920
       --K--E--L--V--V--L--R--L--A--S--L--L--F--K--R--F--L--S--L--R
1921   GAGATGAGTTACCCTTCTCTGAGGACCAGTGGGACTTGCTTCATTATGAGCTGGAAGAAT   1980
       --D--E--L--P--F--S--E--D--Q--W--D--L--L--H--Y--E--L--E--E--Y
1981   ATTTCAATTTGATTCTGTAGcatcgtgctgtggcatgtggtctagtctgctgaggttctg   2040
       --F--N--L--I--L--***........................................
2041   tcgtctgctattgcctgttttccctgtgttgacactcttactgctttcaggggctgttga   2100
       ............................................................
2101   ggcagtgcttctgttttcttgtctattctgcatatctttccccctaggattatggtgatt   2160
       ............................................................
2161   atctgtgttaaaaaataagtccttaaagttactgttttggtgaaattaatattaatgtca   2220
       ............................................................
2221   gcttatggcttttttttgtcatctctgttgtcaacaggattaactcagttctagtgtagt   2280
       ............................................................
2281   gtttactgaatttccacacttattttgaagaccctcaagagtaaatgtggcagagtgaaa   2340
       ............................................................
2341   ggagaagttttaattgaactagtagctttgtgctataatagccttaacaaatggaccctt   2400
       ............................................................
2401   gcagggctttgcagctgctcatctgtttgtttacagtttgttctttccctccttcccctt   2460
       ............................................................
2461   caagtgcacttgttaaactgtgatgaacttgtgattttgtgttttacttgaccaaaacca   2520
       ............................................................
2521   agtgtatatgtttacatgtttttatcctgtttagcttgacatgaaataatttatatttgg   2580
       ............................................................
2581   aaatatatatttaagaattatatatataaaaatatatatgtataagagttatgtatttga   2640
       ............................................................
2641   aaaaaatatataaaagaatatacatcacaatataatatttatgtttatgtaataaagtaa   2700
       ............................................................
2701   atacagagctgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa                   2760
       ............................................