Imprinted Gene Databases

Homo sapiens: KCNK9

Potassium channel, subfamily K, member 9

Luedi et al. Genome Res. 17: , 2007 PDF; Luedi et al. Genome Res. 17: , 2007 Supplement

Species Gene Aliases Location Status Expressed Allele
Mus musculus Kcnk9 Task3  15 D3  Imprinted Maternal
Homo sapiens KCNK9 KT3.2, TASK3, K2p9.1, TASK-3, MGC138268, MGC138270  8q24.3  Imprinted Maternal
1      gtgggacgcgcgcggctgtgagcctgcgggacatgccccccgcgccggctccttgctggc     60
       ............................................................
61     ggccATGAAGAGGCAGAACGTGCGGACTCTGTCCCTCATCGTCTGCACCTTCACCTACCT    120
       ....M--K--R--Q--N--V--R--T--L--S--L--I--V--C--T--F--T--Y--L-
121    GCTGGTGGGCGCCGCCGTGTTCGACGCCCTCGAGTCGGACCACGAGATGCGCGAGGAGGA    180
       -L--V--G--A--A--V--F--D--A--L--E--S--D--H--E--M--R--E--E--E-
181    GAAACTCAAAGCCGAGGAGATCCGGATCAAGGGGAAGTACAACATCAGCAGCGAGGACTA    240
       -K--L--K--A--E--E--I--R--I--K--G--K--Y--N--I--S--S--E--D--Y-
241    CCGGCAGCTGGAGCTGGTGATCCTGCAGTCGGAACCGCACCGCGCCGGCGTCCAGTGGAA    300
       -R--Q--L--E--L--V--I--L--Q--S--E--P--H--R--A--G--V--Q--W--K-
301    ATTCGCCGGCTCCTTCTACTTTGCGATCACGGTCATCACCACCATAGGTTATGGGCACGC    360
       -F--A--G--S--F--Y--F--A--I--T--V--I--T--T--I--G--Y--G--H--A-
361    TGCACCTGGCACCGATGCGGGCAAGGCCTTCTGCATGTTCTACGCCGTGCTGGGCATCCC    420
       -A--P--G--T--D--A--G--K--A--F--C--M--F--Y--A--V--L--G--I--P-
421    GCTGACACTGGTCATGTTCCAGAGCCTGGGCGAGCGCATGAACACCTTCGTGCGCTACCT    480
       -L--T--L--V--M--F--Q--S--L--G--E--R--M--N--T--F--V--R--Y--L-
481    GCTGAAGCGCATTAAGAAGTGCTGTGGCATGCGCAACACTGACGTGTCTATGGAGAACAT    540
       -L--K--R--I--K--K--C--C--G--M--R--N--T--D--V--S--M--E--N--M-
541    GGTGACTGTGGGCTTCTTCTCCTGCATGGGGACGCTGTGCATCGGGGCGGCCGCCTTCTC    600
       -V--T--V--G--F--F--S--C--M--G--T--L--C--I--G--A--A--A--F--S-
601    CCAGTGTGAGGAGTGGAGCTTCTTCCACGCCTACTACTACTGCTTCATCACGTTGACTAC    660
       -Q--C--E--E--W--S--F--F--H--A--Y--Y--Y--C--F--I--T--L--T--T-
661    CATTGGGTTCGGGGACTACGTGGCCCTGCAGACCAAGGGTGCCCTGCAGAAGAAGCCGCT    720
       -I--G--F--G--D--Y--V--A--L--Q--T--K--G--A--L--Q--K--K--P--L-
721    CTACGTGGCCTTTAGCTTTATGTATATCCTGGTGGGGCTGACGGTCATCGGGGCCTTCCT    780
       -Y--V--A--F--S--F--M--Y--I--L--V--G--L--T--V--I--G--A--F--L-
781    CAACCTGGTCGTCCTCAGGTTCTTGACCATGAACAGTGAGGATGAGCGGCGGGATGCTGA    840
       -N--L--V--V--L--R--F--L--T--M--N--S--E--D--E--R--R--D--A--E-
841    AGAGAGGGCATCCCTCGCCGGAAACCGCAACAGCATGGTCATTCACATCCCTGAGGAGCC    900
       -E--R--A--S--L--A--G--N--R--N--S--M--V--I--H--I--P--E--E--P-
901    GCGGCCCAGCCGGCCCAGGTACAAGGCGGACGTCCCGGACCTGCAGTCTGTGTGCTCCTG    960
       -R--P--S--R--P--R--Y--K--A--D--V--P--D--L--Q--S--V--C--S--C-
961    CACCTGCTACCGCTCGCAGGACTATGGCGGCCGCTCGGTGGCACCGCAGAACTCCTTCAG   1020
       -T--C--Y--R--S--Q--D--Y--G--G--R--S--V--A--P--Q--N--S--F--S-
1021   CGCCAAGCTTGCCCCCCACTACTTCCACTCCATCTCTTACAAGATCGAGGAGATCTCACC   1080
       -A--K--L--A--P--H--Y--F--H--S--I--S--Y--K--I--E--E--I--S--P-
1081   AAGCACATTAAAAAACAGCCTCTTCCCATCGCCTATTAGCTCCATCTCTCCTGGGTTACA   1140
       -S--T--L--K--N--S--L--F--P--S--P--I--S--S--I--S--P--G--L--H-
1141   CAGCTTTACCGACCACCAGAGGCTGATGAAACGCCGGAAGTCCGTTTAGgggaactaact   1200
       -S--F--T--D--H--Q--R--L--M--K--R--R--K--S--V--***...........
1201   gcacattcaagagaggcgtccgtggatgctgggtctcactgccaaagccgaacacggctt   1260
       ............................................................
1261   cgggatttctgccttctcaagtggacctctgctgtgctgggcg                    1320
       ...........................................