Imprinted Gene Databases

Homo sapiens: IGF2AS

Insulin-like growth factor 2 antisense
Species Gene Aliases Location Status Expressed Allele
Sus scrofa IGF2AS   Imprinted Paternal
Mus musculus Igf2as   7 69.09 cM  Imprinted Paternal
Homo sapiens IGF2AS PEG8, MGC168198  11p15.5  Imprinted Paternal
1      cggagtcctaggcccgcgggctagaggcactttaccgcccggcgggagcgcctctcctcc     60
       ............................................................
61     gcgtccctcgccccagccccctgcccgccccactttgggaccctccagccgctttcccca    120
       ............................................................
121    caaatgagatctttgcaATGAGCAAACGAAAGTGGCGCGGATTTCGGGGCGCCCAGCAGG    180
       .................M--S--K--R--K--W--R--G--F--R--G--A--Q--Q--E
181    AGCGAGCGCAGCCGCCAGCCGCAAGTCCGCAGCCGTGTCCCGCGCCCCACGCCGGCCTCC    240
       --R--A--Q--P--P--A--A--S--P--Q--P--C--P--A--P--H--A--G--L--P
241    CCGGCGGCAGCCGGAGACGAGCGCCAGCACCGGCGGGACAGCAGCAGATGCGGGCCGAGA    300
       --G--G--S--R--R--R--A--P--A--P--A--G--Q--Q--Q--M--R--A--E--S
301    GCCGGTCAGGGGCGCAGAGGCGGAGGGGATCGGCGCGGCGGGGAGCTCACCGCGAAGCTG    360
       --R--S--G--A--Q--R--R--R--G--S--A--R--R--G--A--H--R--E--A--G
361    GAGGCTGCGTCCGCGGGCGCACCAGGAGCTCAGGCAGCGAGCGATCGAACGCTCTGTGGC    420
       --G--C--V--R--G--R--T--R--S--S--G--S--E--R--S--N--A--L--W--Q
421    AGGCGGTGGACGCTGCTGAAGCTCTGGCTCTGAGCTCACCGCTCCGCCGTCCGTGGGACC    480
       --A--V--D--A--A--E--A--L--A--L--S--S--P--L--R--R--P--W--D--Q
481    AAGCCCAGCATTTTACAAACCCAGCTCCTTTCTCCAAGGGTCCTCAGAGCGCCCCTCCGT    540
       --A--Q--H--F--T--N--P--A--P--F--S--K--G--P--Q--S--A--P--P--S
541    CACCCCCTGCAGGGCGCCGCAGACGAGGCGCTGACCTTGCGCTCACTCCCCTCGCTGGGG    600
       --P--P--A--G--R--R--R--R--G--A--D--L--A--L--T--P--L--A--G--E
601    AAGGACACACTCGCTGGCGTCAGCCCGGCCGGCCTGGGAAGTAGgactaaggacccgaac    660
       --G--H--T--R--W--R--Q--P--G--R--P--G--K--***................
661    tgcaaccctccacaccagacagcacagaccaccccaaggctgctcaatctgcccaaagcc    720
       ............................................................
721    aaaagagctcccctgccaggacctcggtgccgtggagactgcggggaacctgctctgccc    780
       ............................................................
781    acacctgctctggcccctagacggaagcacctggagccaaccacggaactccagatccca    840
       ............................................................
841    gctgtgtgactgaatccacgccagcctctctgagccaaagctgcttgcagaagggggaga    900
       ............................................................
901    tcccagttcgaagactcccgcgcagagcctgtggccctctctgccaggcctcagggtgcc    960
       ............................................................
961    tgagacactcacctctctgcctcgcagttggggctgaggctggggctggctgccagcctc   1020
       ............................................................
1021   agttctgggagcgctggggtcgcctgggccacaggccacagcagctcacctcaggactgg   1080
       ............................................................
1081   gctctctggcctgctggggctcaggctgtggggcaggctgggcagggggctgagctggca   1140
       ............................................................
1141   gcgattcagagccctggggctgggggctggaatccacctcctcccacacaagctcggtgg   1200
       ............................................................
1201   tgactcttcggcccctggggaaaaacaaaaagatattgctgagatgacctcttttaaaag   1260
       ............................................................
1261   caaagcccccctccccatacaccccaagcctgagccctgtcccatccccctccccgggtt   1320
       ............................................................
1321   ccttcaggtcaccttgtcaggatctgggcagcggcttccccctctagcccctcccctgcc   1380
       ............................................................
1381   tagagctccctctttcaaagtataagggagggaagaagtggtgagaagtttgcctagaaa   1440
       ............................................................
1441   gggcttcccggtgctgatggagaggccgagacccttctgttggacaggctgccctgttcc   1500
       ............................................................
1501   tgggtgaggatgggcttctgcctggcactgggggtggagggtgcacacgaatggcccgcc   1560
       ............................................................
1561   ttgaggggtcatggcacggaatatgaaagcctcctccacctccaaacacccccaccttgg   1620
       ............................................................
1621   aaggagataaggagggggccccagcaaaagccactggacacacagctctgcttgacgagg   1680
       ............................................................
1681   ccagtgagggacggcgtggctgtgcttcctggggaaatgaaccccctccccacagacacc   1740
       ............................................................
1741   accctgggtggatcgaggagtctgggtccagggtgcaacagagaaaaacttcatgcatga   1800
       ............................................................
1801   atgagcattcccagggaaactgccttggccccagggcgcctctctgtgccagggaggctg   1860
       ............................................................
1861   ggagagcagcaagggggaccaggtgcgccatcaggaggagagaagctaaacctagggggg   1920
       ............................................................
1921   acatggagggcggttgttgcctctcccggcatttctcctcagtctcctgtccaatttctt   1980
       ............................................................
1981   gctggtggtcaggaggcatagggaggcaggagggaaggaagctttacctgtaaaatggtg   2040
       ............................................................
2041   tatatatgtataaataaaatctctgcgccag                                2100
       ...............................