Imprinted Gene Databases

Homo sapiens: CD81

CD81 molecule
Species Gene Aliases Location Status Expressed Allele
Homo sapiens CD81 S5.7, TAPA1, TSPAN28  11p15.5  Not Imprinted Biallelic
Mus musculus Cd81 Tapa1, Tapa-1, Tspan28  7 69.3 cM  Imprinted Maternal
Bos taurus CD81   29  Not Imprinted Biallelic
Sus scrofa CD81     Not Imprinted Biallelic
1      gagcgagcgcgcaacggcggcgacggcggcgaccccaccgcgcatcctgccaggcctccg     60
       ............................................................
61     gcgcccagcgccccacgcgcccccgcgcccccgcgcccccgcgcccctttcttcgcgccc    120
       ............................................................
121    ccgcccctcggcccgccaggcccccttgccggccacccgccaggccccgcgccggcccgc    180
       ............................................................
181    ccgccgcccaggaccggcccgcgccccgcaggccgcccgccgcccgcgccgccATGGGAG    240
       .....................................................M--G--V
241    TGGAGGGCTGCACCAAGTGCATCAAGTACCTGCTCTTCGTCTTCAATTTCGTCTTCTGGC    300
       --E--G--C--T--K--C--I--K--Y--L--L--F--V--F--N--F--V--F--W--L
301    TGGCTGGAGGCGTGATCCTGGGTGTGGCCCTGTGGCTCCGCCATGACCCGCAGACCACCA    360
       --A--G--G--V--I--L--G--V--A--L--W--L--R--H--D--P--Q--T--T--N
361    ACCTCCTGTATCTGGAGCTGGGAGACAAGCCCGCGCCCAACACCTTCTATGTAGGCATCT    420
       --L--L--Y--L--E--L--G--D--K--P--A--P--N--T--F--Y--V--G--I--Y
421    ACATCCTCATCGCTGTGGGCGCTGTCATGATGTTCGTTGGCTTCCTGGGCTGCTACGGGG    480
       --I--L--I--A--V--G--A--V--M--M--F--V--G--F--L--G--C--Y--G--A
481    CCATCCAGGAATCCCAGTGCCTGCTGGGGACGTTCTTCACCTGCCTGGTCATCCTGTTTG    540
       --I--Q--E--S--Q--C--L--L--G--T--F--F--T--C--L--V--I--L--F--A
541    CCTGTGAGGTGGCCGCCGGCATCTGGGGCTTTGTCAACAAGGACCAGATCGCCAAGGATG    600
       --C--E--V--A--A--G--I--W--G--F--V--N--K--D--Q--I--A--K--D--V
601    TGAAGCAGTTCTATGACCAGGCCCTACAGCAGGCCGTGGTGGATGATGACGCCAACAACG    660
       --K--Q--F--Y--D--Q--A--L--Q--Q--A--V--V--D--D--D--A--N--N--A
661    CCAAGGCTGTGGTGAAGACCTTCCACGAGACGCTTGACTGCTGTGGCTCCAGCACACTGA    720
       --K--A--V--V--K--T--F--H--E--T--L--D--C--C--G--S--S--T--L--T
721    CTGCTTTGACCACCTCAGTGCTCAAGAACAATTTGTGTCCCTCGGGCAGCAACATCATCA    780
       --A--L--T--T--S--V--L--K--N--N--L--C--P--S--G--S--N--I--I--S
781    GCAACCTCTTCAAGGAGGACTGCCACCAGAAGATCGATGACCTCTTCTCCGGGAAGCTGT    840
       --N--L--F--K--E--D--C--H--Q--K--I--D--D--L--F--S--G--K--L--Y
841    ACCTCATCGGCATTGCTGCCATCGTGGTCGCTGTGATCATGATCTTCGAGATGATCCTGA    900
       --L--I--G--I--A--A--I--V--V--A--V--I--M--I--F--E--M--I--L--S
901    GCATGGTGCTGTGCTGTGGCATCCGGAACAGCTCCGTGTACTGAggccccgcagctctgg    960
       --M--V--L--C--C--G--I--R--N--S--S--V--Y--***................
961    ccacagggacctctgcagtgccccctaagtgacccggacacttccgagggggccatcacc   1020
       ............................................................
1021   gcctgtgtatataacgtttccggtattactctgctacacgtagcctttttacttttgggg   1080
       ............................................................
1081   ttttgtttttgttctgaactttcctgttaccttttcagggctgacgtcacatgtaggtgg   1140
       ............................................................
1141   cgtgtatgagtggagacgggcctgggtcttggggactggagggcaggggtccttctgccc   1200
       ............................................................
1201   tggggtcccagggtgctctgcctgctcagccaggcctctcctgggagccactcgcccaga   1260
       ............................................................
1261   gactcagcttggccaacttggggggctgtgtccacccagcccgcccgtcctgtgggctgc   1320
       ............................................................
1321   acagctcaccttgttccctcctgccccggttcgagagccgagtctgtgggcactctctgc   1380
       ............................................................
1381   cttcatgcacctgtcctttctaacacgtcgccttcaactgtaatcacaacatcctgactc   1440
       ............................................................
1441   cgtcatttaataaagaaggaacatcaggcatgctaccaggcctgtgcagtccctcag      1500
       .........................................................