Imprinted Gene Databases

Homo sapiens: CD81

CD81 molecule
Species Gene Aliases Location Status Expressed Allele
Homo sapiens CD81 S5.7, TAPA1, TSPAN28  11p15.5  Not Imprinted Biallelic
Bos taurus CD81   29  Not Imprinted Biallelic
Mus musculus Cd81 Tapa1, Tapa-1, Tspan28  7 69.3 cM  Imprinted Maternal
Sus scrofa CD81     Not Imprinted Biallelic
1      gagcgagcgcgcaacggcggcgacggcggcgaccccaccgcgcatcctgccaggcctccg     60
       ............................................................
61     gcgcccagcgccccacgcgcccccgcgcccccgcgcccccgcgcccctttcttcgcgccc    120
       ............................................................
121    ccgcccctcggcccgccaggcccccttgccggccacccgccaggccccgcgccggcccgc    180
       ............................................................
181    ccgccgcccaggaccggcccgcgccccgcaggccgcccgccgcccgcgccgccATGGGAG    240
       .....................................................M--G--V
241    TGGAGGGCTGCACCAAGTGCATCAAGTACCTGCTCTTCGTCTTCAATTTCGTCTTCTGGC    300
       --E--G--C--T--K--C--I--K--Y--L--L--F--V--F--N--F--V--F--W--L
301    TGGCTGGAGGCGTGATCCTGGGTGTGGCCCTGTGGCTCCGCCATGACCCGCAGACCACCA    360
       --A--G--G--V--I--L--G--V--A--L--W--L--R--H--D--P--Q--T--T--N
361    ACCTCCTGTATCTGGAGCTGGGAGACAAGCCCGCGCCCAACACCTTCTATGTAGGCATCT    420
       --L--L--Y--L--E--L--G--D--K--P--A--P--N--T--F--Y--V--G--I--Y
421    ACATCCTCATCGCTGTGGGCGCTGTCATGATGTTCGTTGGCTTCCTGGGCTGCTACGGGG    480
       --I--L--I--A--V--G--A--V--M--M--F--V--G--F--L--G--C--Y--G--A
481    CCATCCAGGAATCCCAGTGCCTGCTGGGGACGTTCTTCACCTGCCTGGTCATCCTGTTTG    540
       --I--Q--E--S--Q--C--L--L--G--T--F--F--T--C--L--V--I--L--F--A
541    CCTGTGAGGTGGCCGCCGGCATCTGGGGCTTTGTCAACAAGGACCAGATCGCCAAGGATG    600
       --C--E--V--A--A--G--I--W--G--F--V--N--K--D--Q--I--A--K--D--V
601    TGAAGCAGTTCTATGACCAGGCCCTACAGCAGGCCGTGGTGGATGATGACGCCAACAACG    660
       --K--Q--F--Y--D--Q--A--L--Q--Q--A--V--V--D--D--D--A--N--N--A
661    CCAAGGCTGTGGTGAAGACCTTCCACGAGACGCTTGACTGCTGTGGCTCCAGCACACTGA    720
       --K--A--V--V--K--T--F--H--E--T--L--D--C--C--G--S--S--T--L--T
721    CTGCTTTGACCACCTCAGTGCTCAAGAACAATTTGTGTCCCTCGGGCAGCAACATCATCA    780
       --A--L--T--T--S--V--L--K--N--N--L--C--P--S--G--S--N--I--I--S
781    GCAACCTCTTCAAGGAGGACTGCCACCAGAAGATCGATGACCTCTTCTCCGGGAAGCTGT    840
       --N--L--F--K--E--D--C--H--Q--K--I--D--D--L--F--S--G--K--L--Y
841    ACCTCATCGGCATTGCTGCCATCGTGGTCGCTGTGATCATGATCTTCGAGATGATCCTGA    900
       --L--I--G--I--A--A--I--V--V--A--V--I--M--I--F--E--M--I--L--S
901    GCATGGTGCTGTGCTGTGGCATCCGGAACAGCTCCGTGTACTGAggccccgcagctctgg    960
       --M--V--L--C--C--G--I--R--N--S--S--V--Y--***................
961    ccacagggacctctgcagtgccccctaagtgacccggacacttccgagggggccatcacc   1020
       ............................................................
1021   gcctgtgtatataacgtttccggtattactctgctacacgtagcctttttacttttgggg   1080
       ............................................................
1081   ttttgtttttgttctgaactttcctgttaccttttcagggctgacgtcacatgtaggtgg   1140
       ............................................................
1141   cgtgtatgagtggagacgggcctgggtcttggggactggagggcaggggtccttctgccc   1200
       ............................................................
1201   tggggtcccagggtgctctgcctgctcagccaggcctctcctgggagccactcgcccaga   1260
       ............................................................
1261   gactcagcttggccaacttggggggctgtgtccacccagcccgcccgtcctgtgggctgc   1320
       ............................................................
1321   acagctcaccttgttccctcctgccccggttcgagagccgagtctgtgggcactctctgc   1380
       ............................................................
1381   cttcatgcacctgtcctttctaacacgtcgccttcaactgtaatcacaacatcctgactc   1440
       ............................................................
1441   cgtcatttaataaagaaggaacatcaggcatgctaccaggcctgtgcagtccctcag      1500
       .........................................................