Imprinted Gene Databases

Homo sapiens: BLCAP

Bladder cancer associated protein

Schulz et al. Hum. Mol. Genet. 18: 118-127, 2007

Species Gene Aliases Location Status Expressed Allele
Mus musculus Blcap Bc10, AI462828, MGC102074  2 88.0 cM  Imprinted Isoform Dependent
Homo sapiens BLCAP BC10  20q11.2-q12  Imprinted Isoform Dependent
1      gactaagggggcgtctccccggcttcctgcggcgtcggtggcgagctgaggtggaggcag     60
       ............................................................
61     gctgcggcagacggcgacagtggcggcggcgccatggcagggcttgcaggatccctgctg    120
       ............................................................
121    ccttggtgatcccgggctgacagccagagagcacagcggctcagctcctggagagtgagg    180
       ............................................................
181    gttgaagaaagcggagggcagccgcctgcgcccgctggctcccattaggtcggttcctgc    240
       ............................................................
241    agcggtgcccggcagccttggtgaaggccctgcccggcagagatcATGTATTGCCTCCAG    300
       .............................................M--Y--C--L--Q--
301    TGGCTGCTGCCCGTCCTCCTCATCCCCAAGCCCCTCAACCCCGCCCTGTGGTTCAGCCAC    360
       W--L--L--P--V--L--L--I--P--K--P--L--N--P--A--L--W--F--S--H--
361    TCCATGTTCATGGGCTTCTACCTGCTCAGCTTCCTCCTGGAACGGAAGCCTTGCACAATT    420
       S--M--F--M--G--F--Y--L--L--S--F--L--L--E--R--K--P--C--T--I--
421    TGTGCCTTGGTTTTCCTGGCAGCCCTGTTCCTTATCTGCTATAGCTGCTGGGGAAACTGT    480
       C--A--L--V--F--L--A--A--L--F--L--I--C--Y--S--C--W--G--N--C--
481    TTCCTGTACCACTGCTCCGATTCCCCGCTTCCAGAATCGGCGCATGATCCCGGCGTTGTG    540
       F--L--Y--H--C--S--D--S--P--L--P--E--S--A--H--D--P--G--V--V--
541    GGCACCTAAcggcctgccctgttagctttccaaggaagcagaagacgggaggggaggcat    600
       G--T--***...................................................
601    tgacataggtcataaagcattggagtttcaaatcccgcagcctcgcgggtgtcacattcc    660
       ............................................................
661    tgacggcgcctttttggcctgtgatgttttatccttacaatgtgaataatggcactgacc    720
       ............................................................
721    ggtgcttttattgtaaagtcctatagtcgtgggtggtcttgtggttgtgtgtgttctgtc    780
       ............................................................
781    cccatctaggtcctggctggccgcatgaccacccctctcgcctcattactgtgaggagtc    840
       ............................................................
841    tgggtccatcctggtcagctgccccaatgtgacctggggcagataaaatgccagtctcat    900
       ............................................................
901    tgtcacctctgtgacccctccttgtcagggtctccttccttcccagaatgttactgactc    960
       ............................................................
961    ctcagtccctcttctggtttccctttatttctcttctacccttttccttttttggggagt   1020
       ............................................................
1021   acctgtccaagacagggctcatttttgcacttatctcgaatttgaagagattgctgacgc   1080
       ............................................................
1081   ccgagagcctcgctttttcatccttctttccttgttcagcaggctagacagaaacatgtc   1140
       ............................................................
1141   ttgactgttagttgtccacaaatcttcagtattttctccacttcatttttaagaaaggaa   1200
       ............................................................
1201   gcaacagatagatgttgctctttcacctgggtgtctgggctcaagctttcccgcccagcc   1260
       ............................................................
1261   tcacttcctttgcccttcctcctgcctttctcaactgtcccaaggagggggcctcattgt   1320
       ............................................................
1321   gtctcccgtgcatgctctgcagcattgaagtatggtgtgttcacgtagttctagcagtcc   1380
       ............................................................
1381   ccagctgagtgagtgggagagtacctgtgtgtttcgtaacggccttgatccccttgatag   1440
       ............................................................
1441   atgtttggatattttttggtgtgccctgtgtgtgtgtgtgtacaaatacatgtgtatatt   1500
       ............................................................
1501   ccttttaaagaagctttatcgaacgtggtctgattttgaggtttagcaatagctagctat   1560
       ............................................................
1561   atatggtaggtgccgctacagtttttatttagcatggggattgcagagtgaccagcacac   1620
       ............................................................
1621   tggactccgaggtggttcagacaagacagaggggagcagtggccatcatcctcccgccag   1680
       ............................................................
1681   gagcttcttcgttcctgcgcatatagactgtacattatgaagaatacccaggaagacttt   1740
       ............................................................
1741   gtgactgtcacttgctgctttttctgcgcttcagtaacaagtgttggcaaacgagacttt   1800
       ............................................................
1801   ctcctggcccctgcctgctggagatcagcatgcctgtcctttcagtctgatccatccatc   1860
       ............................................................
1861   tctctcttgcctgaggggaaagagagatgggccaggcagagaacagaactggaggcagtc   1920
       ............................................................
1921   catctagggaatgggactgtgaggccatacttgtgaaacgtctggactgctattctagag   1980
       ............................................................
1981   cttttatttggtgtgttcgttgcacagctgtttgaaatgtttaataaagctttataaact   2040
       ............................................................
2041   ttaaaaaaaaaaaaaaa                                              2100
       .................