Imprinted Gene Databases

Homo sapiens: ATP10A

ATPase, class V, type 10A
Species Gene Aliases Location Status Expressed Allele
Mus musculus Atp10a pfatp, Atp10c  7 B5  Conflicting Data Maternal
Homo sapiens ATP10A ATPVA, ATPVC, ATP10C, KIAA0566  15q11.2  Imprinted Maternal
Macaca mulatta ATP10A   Tissue Dependent Maternal
1      gcggggagctcgcaccgccgcgcccgggccgcgagtgatgataacctaagaggccggcgc     60
       ............................................................
61     gggcgggcgtgagcggcggaggagccgggcgcggcgacacgcggccATGGAGCGGGAGCC    120
       ..............................................M--E--R--E--P-
121    GGCGGGGACCGAGGAGCCCGGGCCTCCGGGACGGCGGAGGCGCCGAGAGGGCAGGACGCG    180
       -A--G--T--E--E--P--G--P--P--G--R--R--R--R--R--E--G--R--T--R-
181    CACGGTGCGCTCCAACCTGCTGCCGCCCCCGGGCGCCGAGGACCCTGCGGCTGGCGCGGC    240
       -T--V--R--S--N--L--L--P--P--P--G--A--E--D--P--A--A--G--A--A-
241    CAAGGGCGAGCGGCGACGGCGGCGCGGGTGTGCCCAGCACCTGGCCGACAACCGGCTCAA    300
       -K--G--E--R--R--R--R--R--G--C--A--Q--H--L--A--D--N--R--L--K-
301    GACTACCAAGTACACGCTGCTGTCCTTCCTGCCCAAGAACCTGTTCGAGCAGTTCCACCG    360
       -T--T--K--Y--T--L--L--S--F--L--P--K--N--L--F--E--Q--F--H--R-
361    CCCGGCCAACGTGTACTTTGTCTTCATCGCGCTGCTCAACTTCGTGCCGGCGGTGAACGC    420
       -P--A--N--V--Y--F--V--F--I--A--L--L--N--F--V--P--A--V--N--A-
421    CTTCCAGCCCGGCCTGGCACTGGCGCCGGTGCTCTTCATCCTGGCCATCACGGCCTTCAG    480
       -F--Q--P--G--L--A--L--A--P--V--L--F--I--L--A--I--T--A--F--R-
481    GGACCTGTGGGAGGACTACAGCCGCCACCGCTCCGACCACAAGATCAACCACCTGGGCTG    540
       -D--L--W--E--D--Y--S--R--H--R--S--D--H--K--I--N--H--L--G--C-
541    CCTGGTCTTCAGCAGGGAAGAAAAGAAATACGTGAACCGATTCTGGAAAGAAATCCACGT    600
       -L--V--F--S--R--E--E--K--K--Y--V--N--R--F--W--K--E--I--H--V-
601    GGGAGACTTTGTGCGTCTTCGCTGCAACGAAATCTTCCCTGCGGACATTCTGCTGCTCTC    660
       -G--D--F--V--R--L--R--C--N--E--I--F--P--A--D--I--L--L--L--S-
661    CTCCAGTGACCCCGACGGGCTATGCCACATCGAGACCGCCAACCTGGATGGAGAGACCAA    720
       -S--S--D--P--D--G--L--C--H--I--E--T--A--N--L--D--G--E--T--N-
721    CCTGAAGCGGCGGCAGGTGGTCCGCGGCTTCTCGGAGCTTGTCTCCGAATTCAATCCTTT    780
       -L--K--R--R--Q--V--V--R--G--F--S--E--L--V--S--E--F--N--P--L-
781    GACGTTCACCAGCGTGATCGAATGCGAGAAGCCAAACAACGACCTGAGTAGGTTTCGCGG    840
       -T--F--T--S--V--I--E--C--E--K--P--N--N--D--L--S--R--F--R--G-
841    CTGCATCATACATGACAACGGGAAAAAGGCCGGGCTGTATAAAGAAAACCTGCTGCTGAG    900
       -C--I--I--H--D--N--G--K--K--A--G--L--Y--K--E--N--L--L--L--R-
901    GGGCTGCACCCTTAGGAACACGGACGCAGTCGTCGGCATTGTCATCTACGCAGGACATGA    960
       -G--C--T--L--R--N--T--D--A--V--V--G--I--V--I--Y--A--G--H--E-
961    AACCAAGGCTCTGCTGAACAACAGTGGGCCCCGCTACAAGCGCAGCAAGCTGGAGAGGCA   1020
       -T--K--A--L--L--N--N--S--G--P--R--Y--K--R--S--K--L--E--R--Q-
1021   GATGAACTGCGACGTGCTCTGGTGTGTCCTGCTCCTTGTTTGCATGTCTCTGTTTTCAGC   1080
       -M--N--C--D--V--L--W--C--V--L--L--L--V--C--M--S--L--F--S--A-
1081   AGTCGGACATGGACTGTGGATATGGCGGTATCAAGAGAAGAAGTCATTATTTTATGTCCC   1140
       -V--G--H--G--L--W--I--W--R--Y--Q--E--K--K--S--L--F--Y--V--P-
1141   CAAGTCTGATGGAAGCTCCTTATCCCCAGTCACAGCTGCAGTTTACTCATTTTTAACAAT   1200
       -K--S--D--G--S--S--L--S--P--V--T--A--A--V--Y--S--F--L--T--M-
1201   GATAATAGTTCTGCAGGTTTTGATCCCAATTTCCTTATACGTTTCCATTGAAATTGTTAA   1260
       -I--I--V--L--Q--V--L--I--P--I--S--L--Y--V--S--I--E--I--V--K-
1261   AGCATGCCAAGTGTACTTCATTAACCAGGACATGCAGTTGTATGACGAAGAAACAGACTC   1320
       -A--C--Q--V--Y--F--I--N--Q--D--M--Q--L--Y--D--E--E--T--D--S-
1321   GCAGCTGCAGTGCCGAGCTCTGAACATCACGGAAGACTTAGGACAGATACAGTACATTTT   1380
       -Q--L--Q--C--R--A--L--N--I--T--E--D--L--G--Q--I--Q--Y--I--F-
1381   CTCAGATAAAACTGGCACTTTGACAGAGAATAAGATGGTTTTCCGAAGATGCACTGTGTC   1440
       -S--D--K--T--G--T--L--T--E--N--K--M--V--F--R--R--C--T--V--S-
1441   TGGTGTAGAATATTCTCATGATGCAAATGCGCAGCGTCTGGCCAGGTACCAAGAGGCAGA   1500
       -G--V--E--Y--S--H--D--A--N--A--Q--R--L--A--R--Y--Q--E--A--D-
1501   CTCGGAGGAGGAGGAGGTGGTGCCCAGAGGGGGCTCGGTGTCCCAGCGCGGCAGCATCGG   1560
       -S--E--E--E--E--V--V--P--R--G--G--S--V--S--Q--R--G--S--I--G-
1561   CAGCCACCAGAGTGTCCGGGTGGTGCACAGAACCCAGAGCACCAAGTCCCACCGGCGCAC   1620
       -S--H--Q--S--V--R--V--V--H--R--T--Q--S--T--K--S--H--R--R--T-
1621   GGGCAGCCGGGCCGAGGCCAAGAGGGCCAGCATGCTGTCCAAGCACACGGCCTTCAGCAG   1680
       -G--S--R--A--E--A--K--R--A--S--M--L--S--K--H--T--A--F--S--S-
1681   CCCCATGGAGAAGGATATCACGCCCGACCCAAAGCTGCTGGAGAAGGTGAGTGAGTGTGA   1740
       -P--M--E--K--D--I--T--P--D--P--K--L--L--E--K--V--S--E--C--D-
1741   CAAGAGCCTAGCCGTGGCGAGGCATCAGGAGCACCTGCTGGCCCACCTCTCGCCTGAGCT   1800
       -K--S--L--A--V--A--R--H--Q--E--H--L--L--A--H--L--S--P--E--L-
1801   GTCTGACGTCTTTGATTTCTTCATCGCACTCACCATCTGCAACACAGTCGTCGTCACGTC   1860
       -S--D--V--F--D--F--F--I--A--L--T--I--C--N--T--V--V--V--T--S-
1861   CCCGGATCAGCCACGAACAAAGGTGAGGGTGAGGTTTGAGCTGAAGTCCCCGGTGAAGAC   1920
       -P--D--Q--P--R--T--K--V--R--V--R--F--E--L--K--S--P--V--K--T-
1921   GATAGAAGACTTCCTGCGGAGGTTCACACCCAGCTGCCTGACCTCAGGCTGCAGCAGCAT   1980
       -I--E--D--F--L--R--R--F--T--P--S--C--L--T--S--G--C--S--S--I-
1981   CGGGAGCCTGGCCGCCAACAAGTCCAGCCACAAGTTGGGCTCCAGCTTCCCGTCCACCCC   2040
       -G--S--L--A--A--N--K--S--S--H--K--L--G--S--S--F--P--S--T--P-
2041   GTCCAGCGACGGCATGCTTCTCAGGCTGGAGGAGAGGCTGGGCCAGCCCACCTCGGCCAT   2100
       -S--S--D--G--M--L--L--R--L--E--E--R--L--G--Q--P--T--S--A--I-
2101   CGCCAGCAACGGCTACAGCAGCCAGGCGGACAACTGGGCCTCGGAGCTTGCTCAGGAGCA   2160
       -A--S--N--G--Y--S--S--Q--A--D--N--W--A--S--E--L--A--Q--E--Q-
2161   GGAGTCAGAGCGCGAGCTGCGGTACGAGGCGGAGAGCCCGGATGAGGCCGCACTGGTGTA   2220
       -E--S--E--R--E--L--R--Y--E--A--E--S--P--D--E--A--A--L--V--Y-
2221   TGCGGCCAGAGCCTACAACTGCGTGCTTGTGGAGCGGCTGCACGACCAAGTGTCAGTGGA   2280
       -A--A--R--A--Y--N--C--V--L--V--E--R--L--H--D--Q--V--S--V--E-
2281   GCTGCCCCACCTGGGCAGGCTCACCTTCGAGCTCCTGCACACACTGGGTTTCGATTCCGT   2340
       -L--P--H--L--G--R--L--T--F--E--L--L--H--T--L--G--F--D--S--V-
2341   CCGCAAGAGGATGTCAGTGGTGATCCGGCACCCGCTTACCGATGAGATCAACGTCTACAC   2400
       -R--K--R--M--S--V--V--I--R--H--P--L--T--D--E--I--N--V--Y--T-
2401   CAAGGGGGCCGACTCAGTGGTCATGGATCTCCTGCAGCCCTGCTCTTCAGTTGACGCCAG   2460
       -K--G--A--D--S--V--V--M--D--L--L--Q--P--C--S--S--V--D--A--R-
2461   AGGGAGGCATCAAAAAAAGATTCGGAGCAAAACTCAGAATTACCTCAACGTGTATGCGGC   2520
       -G--R--H--Q--K--K--I--R--S--K--T--Q--N--Y--L--N--V--Y--A--A-
2521   GGAAGGCCTGCGCACCTTGTGCATCGCCAAGAGAGTTCTGAGTAAAGAAGAGTATGCCTG   2580
       -E--G--L--R--T--L--C--I--A--K--R--V--L--S--K--E--E--Y--A--C-
2581   CTGGTTGCAAAGCCACCTAGAAGCCGAATCCTCCCTGGAAAACAGCGAGGAGCTCCTCTT   2640
       -W--L--Q--S--H--L--E--A--E--S--S--L--E--N--S--E--E--L--L--F-
2641   CCAGTCTGCCATTCGCCTGGAGACCAACCTGCACTTGTTAGGTGCCACTGGGATTGAAGA   2700
       -Q--S--A--I--R--L--E--T--N--L--H--L--L--G--A--T--G--I--E--D-
2701   CCGCCTGCAGGACGGAGTCCCTGAAACTATTTCTAAATTGCGTCAAGCGGGCCTGCAGAT   2760
       -R--L--Q--D--G--V--P--E--T--I--S--K--L--R--Q--A--G--L--Q--I-
2761   TTGGGTTCTCACTGGTGACAAACAAGAAACAGCTGTCAACATTGCATATGCCTGCAAACT   2820
       -W--V--L--T--G--D--K--Q--E--T--A--V--N--I--A--Y--A--C--K--L-
2821   GCTGGACCACGACGAGGAGGTCATCACCCTGAATGCCACCTCCCAGGAGGCGTGTGCAGC   2880
       -L--D--H--D--E--E--V--I--T--L--N--A--T--S--Q--E--A--C--A--A-
2881   CCTGCTAGACCAGTGCCTATGCTACGTGCAGTCCAGAGGCCTCCAGAGAGCCCCTGAGAA   2940
       -L--L--D--Q--C--L--C--Y--V--Q--S--R--G--L--Q--R--A--P--E--K-
2941   GACCAAGGGCAAAGTGAGCATGAGGTTCTCCTCTCTCTGCCCACCCTCCACGTCCACTGC   3000
       -T--K--G--K--V--S--M--R--F--S--S--L--C--P--P--S--T--S--T--A-
3001   CTCTGGCCGCAGACCCAGCCTCGTGATCGATGGGAGAAGCCTGGCCTACGCTCTCGAGAA   3060
       -S--G--R--R--P--S--L--V--I--D--G--R--S--L--A--Y--A--L--E--K-
3061   AAACCTGGAGGACAAATTCCTCTTCCTTGCCAAGCAGTGCCGCTCCGTCCTCTGCTGTCG   3120
       -N--L--E--D--K--F--L--F--L--A--K--Q--C--R--S--V--L--C--C--R-
3121   GTCGACGCCTCTGCAGAAGAGCATGGTGGTGAAGCTGGTGCGGAGCAAGCTCAAGGCCAT   3180
       -S--T--P--L--Q--K--S--M--V--V--K--L--V--R--S--K--L--K--A--M-
3181   GACCCTGGCCATAGGTGATGGAGCCAATGATGTCAGCATGATCCAGGTGGCAGATGTGGG   3240
       -T--L--A--I--G--D--G--A--N--D--V--S--M--I--Q--V--A--D--V--G-
3241   TGTGGGAATCTCCGGCCAGGAGGGTATGCAGGCAGTGATGGCCAGCGACTTTGCAGTGCC   3300
       -V--G--I--S--G--Q--E--G--M--Q--A--V--M--A--S--D--F--A--V--P-
3301   GAAATTCCGATACCTGGAGAGGCTCTTGATTCTTCACGGGCATTGGTGCTACTCCCGACT   3360
       -K--F--R--Y--L--E--R--L--L--I--L--H--G--H--W--C--Y--S--R--L-
3361   TGCCAACATGGTGCTGTACTTCTTCTACAAAAACACAATGTTCGTGGGCCTCCTGTTTTG   3420
       -A--N--M--V--L--Y--F--F--Y--K--N--T--M--F--V--G--L--L--F--W-
3421   GTTCCAGTTTTTCTGTGGCTTCTCTGCATCTACCATGATTGACCAGTGGTATCTAATCTT   3480
       -F--Q--F--F--C--G--F--S--A--S--T--M--I--D--Q--W--Y--L--I--F-
3481   CTTTAATCTGCTCTTCTCGTCACTTCCCCCGCTCGTGACTGGGGTGCTGGACAGGGATGT   3540
       -F--N--L--L--F--S--S--L--P--P--L--V--T--G--V--L--D--R--D--V-
3541   GCCAGCCAATGTGCTGCTGACCAACCCGCAGCTCTACAAGAGTGGCCAGAACATGGAGGA   3600
       -P--A--N--V--L--L--T--N--P--Q--L--Y--K--S--G--Q--N--M--E--E-
3601   ATACCGGCCACGAACGTTCTGGTTTAACATGGCCGACGCCGCCTTCCAGAGCCTGGTTTG   3660
       -Y--R--P--R--T--F--W--F--N--M--A--D--A--A--F--Q--S--L--V--C-
3661   CTTTTCCATTCCTTACCTGGCCTACTATGACTCGAACGTGGACCTGTTTACCTGGGGGAC   3720
       -F--S--I--P--Y--L--A--Y--Y--D--S--N--V--D--L--F--T--W--G--T-
3721   CCCTATTGTGACAATCGCGCTGCTCACTTTCCTGCTCCACCTGGGCATTGAAACCAAAAC   3780
       -P--I--V--T--I--A--L--L--T--F--L--L--H--L--G--I--E--T--K--T-
3781   CTGGACCTGGCTCAACTGGATAACGTGTGGCTTCAGTGTCCTTTTGTTTTTCACCGTGGC   3840
       -W--T--W--L--N--W--I--T--C--G--F--S--V--L--L--F--F--T--V--A-
3841   TTTGATTTACAATGCGTCTTGTGCCACGTGCTATCCTCCGTCCAACCCTTACTGGACTAT   3900
       -L--I--Y--N--A--S--C--A--T--C--Y--P--P--S--N--P--Y--W--T--M-
3901   GCAAGCCTTACTGGGTGACCCAGTGTTTTACTTGACTTGCCTGATGACGCCTGTCGCTGC   3960
       -Q--A--L--L--G--D--P--V--F--Y--L--T--C--L--M--T--P--V--A--A-
3961   ACTGCTGCCCAGATTGTTTTTCAGATCCCTCCAGGGGAGGGTTTTCCCCACACAACTTCA   4020
       -L--L--P--R--L--F--F--R--S--L--Q--G--R--V--F--P--T--Q--L--Q-
4021   GCTGGCACGTCAGTTGACCAGGAAGTCCCCCAGGAGATGCAGTGCTCCCAAAGAGACCTT   4080
       -L--A--R--Q--L--T--R--K--S--P--R--R--C--S--A--P--K--E--T--F-
4081   TGCTCAGGGACGCCTCCCGAAGGACTCGGGAACCGAGCACTCATCAGGGAGGACAGTCAA   4140
       -A--Q--G--R--L--P--K--D--S--G--T--E--H--S--S--G--R--T--V--K-
4141   GACCTCTGTGCCCCTGTCCCAGCCTTCTTGGCACACACAGCAGCCGGTCTGCTCCCTGGA   4200
       -T--S--V--P--L--S--Q--P--S--W--H--T--Q--Q--P--V--C--S--L--E-
4201   GGCCAGCGGGGAGCCCAGCACAGTGGACATGAGCATGCCAGTGAGGGAGCACACCCTGCT   4260
       -A--S--G--E--P--S--T--V--D--M--S--M--P--V--R--E--H--T--L--L-
4261   GGAGGGGCTGAGCGCACCGGCCCCCATGTCCTCTGCGCCAGGGGAGGCTGTCCTGAGGAG   4320
       -E--G--L--S--A--P--A--P--M--S--S--A--P--G--E--A--V--L--R--S-
4321   TCCAGGAGGGTGTCCTGAGGAGTCCAAGGTGAGAGCTGCCAGCACCGGCAGGGTGACCCC   4380
       -P--G--G--C--P--E--E--S--K--V--R--A--A--S--T--G--R--V--T--P-
4381   CCTGTCTTCCCTCTTCAGCCTGCCTACCTTCAGCTTACTCAACTGGATTTCCTCCTGGTC   4440
       -L--S--S--L--F--S--L--P--T--F--S--L--L--N--W--I--S--S--W--S-
4441   GCTGGTCAGCAGGCTGGGGAGTGTCTTACAGTTCTCCCGGACGGAGCAGCTTGCAGATGG   4500
       -L--V--S--R--L--G--S--V--L--Q--F--S--R--T--E--Q--L--A--D--G-
4501   ACAAGCGGGACGTGGACTTCCTGTCCAGCCCCACTCAGGCCGATCAGGACTTCAAGGGCC   4560
       -Q--A--G--R--G--L--P--V--Q--P--H--S--G--R--S--G--L--Q--G--P-
4561   AGACCACAGACTACTTATAGGAGCATCTTCAAGGCGGTCACAGTGAaaaccttgaaatgg   4620
       -D--H--R--L--L--I--G--A--S--S--R--R--S--Q--***..............
4621   ccttttttaatatatataaataaatgttaatattatttatgtttattatttgcacagaag   4680
       ............................................................
4681   agttctagggagatgtatttctaaatgtttcccaggctaatacaggaaacaagaggtacc   4740
       ............................................................
4741   aaaaaagaaagtttattttttaaaattctaagtagagtatattgaaaagaaaaagaagag   4800
       ............................................................
4801   ccttaacatatataaaagtttaaagaagagtaacacttgaaaagtgtgtttagatttatt   4860
       ............................................................
4861   ttttcatctcatttttaagaacaagcagtacgatttgttttcttcaacatgtgtgactgc   4920
       ............................................................
4921   gcactgagtacaaatgtgtgactgctcatggttaatgcaggcaggtgtgaacatggggga   4980
       ............................................................
4981   acaatgagcagagatggcagagggcagagcacatggcccccagaggcttccagtctcact   5040
       ............................................................
5041   gacacaggagggctgggctccacttcatccagatgaaggaaaggaagacctcaagaaaaa   5100
       ............................................................
5101   ttcacagttgagtgcatcccagcattctgttccgggcaggcatttcaggaagaccgcctt   5160
       ............................................................
5161   gtaggtattacatccctggtgtcgtattttgcctgttaaatcgtaacaagcaataaacaa   5220
       ............................................................
5221   ctttcactttgcaaa                                                5280
       ...............