Imprinted Gene Databases

Homo sapiens: ASB4

Ankyrin repeat and SOCS box-containing 4
Species Gene Aliases Location Status Expressed Allele
Bos taurus ASB4   Not Imprinted Biallelic
Sus scrofa ASB4   Not Imprinted Biallelic
Homo sapiens ASB4 ASB-4, MGC142039, MGC142041  7q21-q22  Not Imprinted Biallelic
Mus musculus Asb4 AV117194, AW060255, 8430401O13Rik  6 0.6 cM  Imprinted Maternal
1      ATGGACGGCACCACTGCCCCTGTCACTAAATCTGGAGCTGCCAAGTTAGTTAAGAGAAAT     60
       M--D--G--T--T--A--P--V--T--K--S--G--A--A--K--L--V--K--R--N--
61     TTCCTTGAGGCGCTAAAGTCCAATGACTTCGGAAAATTGAAGGCTATTTTGATCCAAAGG    120
       F--L--E--A--L--K--S--N--D--F--G--K--L--K--A--I--L--I--Q--R--
121    CAAATAGATGTGGACACTGTTTTTGAAGTCGAAGATGAGAATATGGTTTTGGCATCTTAT    180
       Q--I--D--V--D--T--V--F--E--V--E--D--E--N--M--V--L--A--S--Y--
181    AAACAAGGTTACTGGTTGCCTAGCTATAAATTGAAGTCTTCCTGGGCCACAGGCCTCCAT    240
       K--Q--G--Y--W--L--P--S--Y--K--L--K--S--S--W--A--T--G--L--H--
241    CTCTCTGTCTTGTTTGGCCATGTGGAATGTCTTCTGGTGCTACTGGACCACAATGCTACA    300
       L--S--V--L--F--G--H--V--E--C--L--L--V--L--L--D--H--N--A--T--
301    ATCAACTGTAGACCCAATGGGAAAACCCCTCTTCACGTGGCTTGTGAAATGGCCAATGTG    360
       I--N--C--R--P--N--G--K--T--P--L--H--V--A--C--E--M--A--N--V--
361    GATTGTGTTAAGATCCTCTGTGATCGTGGGGCAAAGCTCAATTGCTACTCCTTAAGTGGA    420
       D--C--V--K--I--L--C--D--R--G--A--K--L--N--C--Y--S--L--S--G--
421    CACACAGCTTTGCACTTTTGTACAACTCCAAGTTCCATTCTCTGTGCCAAGCAATTGGTT    480
       H--T--A--L--H--F--C--T--T--P--S--S--I--L--C--A--K--Q--L--V--
481    TGGAGAGGGGCGAATGTGAACATGAAGACCAACAACCAAGATGAGGAGACGCCCTTGCAC    540
       W--R--G--A--N--V--N--M--K--T--N--N--Q--D--E--E--T--P--L--H--
541    ACGGCTGCCCACTTCGGCCTTTCGGAGCTGGTGGCCTTCTACGTGGAACACGGGGCCATA    600
       T--A--A--H--F--G--L--S--E--L--V--A--F--Y--V--E--H--G--A--I--
601    GTGGACAGCGTGAATGCCCACATGGAGACCCCCCTGGCCATCGCCGCCTACTGGGCCCTC    660
       V--D--S--V--N--A--H--M--E--T--P--L--A--I--A--A--Y--W--A--L--
661    CGCTTTAAGGAGCAGGAGTACAGCACGGAGCACCACCTGGTCTGCCGCATGCTGCTTGAC    720
       R--F--K--E--Q--E--Y--S--T--E--H--H--L--V--C--R--M--L--L--D--
721    TACAAAGCCGAAGTCAATGCCCGAGATGACGACTTTAAATCTCCCCTCCACAAGGCAGCC    780
       Y--K--A--E--V--N--A--R--D--D--D--F--K--S--P--L--H--K--A--A--
781    TGGAACTGTGACCACGTGCTCATGCACATGATGCTGGAAGCTGGCGCCGAAGCCAATCTC    840
       W--N--C--D--H--V--L--M--H--M--M--L--E--A--G--A--E--A--N--L--
841    ATGGATATCAACGGCTGTGCTGCCATCCAGTACGTGCTGAAGGTCACCTCCGTGCGCCCT    900
       M--D--I--N--G--C--A--A--I--Q--Y--V--L--K--V--T--S--V--R--P--
901    GCTGCCCAGCCTGAGATCTGCTACCAGCTCCTGTTGAACCATGGGGCTGCCCGAATATAC    960
       A--A--Q--P--E--I--C--Y--Q--L--L--L--N--H--G--A--A--R--I--Y--
961    CCTCCACAGTTCCATAAGGTGAGGCTCTGCCCAGTGGTCAGCAGGTTGAGGAAGATTCAA   1020
       P--P--Q--F--H--K--V--R--L--C--P--V--V--S--R--L--R--K--I--Q--
1021   ATGGCAGCCTTGTCTGAAATCTCCAAGTAActcaagcttgcttgaggcttgagtcctggg   1080
       M--A--A--L--S--E--I--S--K--***..............................
1081   ctaactacctctgatcctctttgaccttccattacatacctaatcctagctgtctcctca   1140
       ............................................................
1141   tctcatcctagtctaggtttgcttgaaattgggtgtgagagctagaatgagaaaaagagt   1200
       ............................................................
1201   agcaaataatttgttttgccttgtgtgaacaccagtgcactggtggcttcctgagggact   1260
       ............................................................
1261   gaggtaagtctgccagaaaggtgaatagtgttagacaggcatacatttgccatcttttaa   1320
       ............................................................
1321   acagaatgactgatctaaagatgactcagcctgctttgaaattagcttgtagccatgaaa   1380
       ............................................................
1381   gggccacccgattttccagtttaatgaaagctaacgtttattaagtactaaaattatatt   1440
       ............................................................
1441   tattatgtataataaataagcacactgttataagcaaaaaaaaaaaaaaaaaaa         1500
       ......................................................