Imprinted Gene Databases

Homo sapiens: GLI3

GLI family zinc finger 3

Luedi et al. Genome Res. 17: , 2007 PDF; Luedi et al. Genome Res. 17: , 2007 Supplement

Species Gene Aliases Location Status Expressed Allele
Homo sapiens GLI3 PHS, ACLS, GCPS, PAPA, PAPB, PAP-A, PAPA1, PPDIV  7p13  Predicted Maternal
1      ccgcgggtctatgggaagttcggggacttgacagccgctgccgccgcagggcatttttgg     60
       ............................................................
61     tcgaagagagctgaagtaatgagaagacatcATGGAGGCCCAGTCCCACAGCTCCACGAC    120
       ...............................M--E--A--Q--S--H--S--S--T--T-
121    CACTGAAAAGAAAAAAGTTGAGAATTCCATAGTGAAGTGCTCCACTCGAACAGATGTGAG    180
       -T--E--K--K--K--V--E--N--S--I--V--K--C--S--T--R--T--D--V--S-
181    CGAGAAAGCCGTTGCCTCCAGCACCACTTCTAATGAGGATGAAAGTCCTGGACAGACTTA    240
       -E--K--A--V--A--S--S--T--T--S--N--E--D--E--S--P--G--Q--T--Y-
241    TCACAGAGAGAGAAGAAACGCAATCACTATGCAGCCACAGAATGTCCAGGGGCTCAGCAA    300
       -H--R--E--R--R--N--A--I--T--M--Q--P--Q--N--V--Q--G--L--S--K-
301    AGTCAGTGAGGAACCTTCAACATCGAGTGACGAGAGGGCCTCATTGATCAAGAAAGAGAT    360
       -V--S--E--E--P--S--T--S--S--D--E--R--A--S--L--I--K--K--E--I-
361    CCATGGGTCCCTGCCACACGTGGCGGAGCCCTCTGTGCCGTACCGCGGGACGGTGTTTGC    420
       -H--G--S--L--P--H--V--A--E--P--S--V--P--Y--R--G--T--V--F--A-
421    CATGGACCCCAGGAATGGTTACATGGAGCCCCACTACCACCCTCCTCATCTTTTCCCTGC    480
       -M--D--P--R--N--G--Y--M--E--P--H--Y--H--P--P--H--L--F--P--A-
481    CTTCCATCCTCCTGTACCAATTGATGCCAGACATCATGAGGGCCGTTACCATTACGATCC    540
       -F--H--P--P--V--P--I--D--A--R--H--H--E--G--R--Y--H--Y--D--P-
541    ATCTCCGATTCCTCCATTGCATATGACTTCCGCCTTATCTAGTAGCCCTACGTATCCGGA    600
       -S--P--I--P--P--L--H--M--T--S--A--L--S--S--S--P--T--Y--P--D-
601    CCTGCCCTTCATTAGGATCTCCCCACACCGGAACCCCACTGCTGCTTCCGAGTCTCCCTT    660
       -L--P--F--I--R--I--S--P--H--R--N--P--T--A--A--S--E--S--P--F-
661    CAGCCCTCCACATCCCTACATTAATCCCTACATGGACTATATCCGCTCCTTGCACAGCAG    720
       -S--P--P--H--P--Y--I--N--P--Y--M--D--Y--I--R--S--L--H--S--S-
721    CCCATCGCTCTCCATGATCTCAGCAACCCGTGGGCTGAGCCCTACAGATGCGCCCCATGC    780
       -P--S--L--S--M--I--S--A--T--R--G--L--S--P--T--D--A--P--H--A-
781    AGGAGTCAGCCCAGCAGAATACTATCATCAGATGGCCCTGCTAACTGGCCAGCGCAGCCC    840
       -G--V--S--P--A--E--Y--Y--H--Q--M--A--L--L--T--G--Q--R--S--P-
841    CTATGCAGACATTATTCCCTCAGCTGCCACCGCCGGCACGGGGGCCATCCACATGGAATA    900
       -Y--A--D--I--I--P--S--A--A--T--A--G--T--G--A--I--H--M--E--Y-
901    TCTTCATGCTATGGATAGCACCAGATTCTCCAGCCCCAGGCTGTCAGCCAGGCCGAGCCG    960
       -L--H--A--M--D--S--T--R--F--S--S--P--R--L--S--A--R--P--S--R-
961    AAAACGTACACTGTCCATATCACCACTCTCCGATCATAGCTTTGACCTTCAGACCATGAT   1020
       -K--R--T--L--S--I--S--P--L--S--D--H--S--F--D--L--Q--T--M--I-
1021   AAGGACGTCTCCCAACTCCTTGGTCACGATTCTCAATAATTCCCGTAGCAGCTCTTCAGC   1080
       -R--T--S--P--N--S--L--V--T--I--L--N--N--S--R--S--S--S--S--A-
1081   AAGTGGCTCCTATGGTCACTTATCTGCAAGTGCAATCAGCCCTGCCTTGAGCTTCACCTA   1140
       -S--G--S--Y--G--H--L--S--A--S--A--I--S--P--A--L--S--F--T--Y-
1141   CTCTTCCGCGCCCGTCTCTCTCCACATGCATCAGCAGATCCTAAGCCGACAACAGAGCTT   1200
       -S--S--A--P--V--S--L--H--M--H--Q--Q--I--L--S--R--Q--Q--S--L-
1201   AGGTTCAGCCTTTGGACACAGCCCTCCACTCATCCACCCTGCCCCAACTTTTCCAACACA   1260
       -G--S--A--F--G--H--S--P--P--L--I--H--P--A--P--T--F--P--T--Q-
1261   GAGGCCTATTCCAGGGATCCCTACGGTTCTGAACCCCGTCCAGGTCAGCTCCGGCCCTTC   1320
       -R--P--I--P--G--I--P--T--V--L--N--P--V--Q--V--S--S--G--P--S-
1321   TGAGTCCTCACAGAACAAGCCCACGAGTGAGTCTGCAGTGAGCAGCACTGGTGACCCGAT   1380
       -E--S--S--Q--N--K--P--T--S--E--S--A--V--S--S--T--G--D--P--M-
1381   GCACAACAAGAGGTCCAAGATCAAACCCGATGAAGACCTCCCCAGCCCAGGGGCTCGGGG   1440
       -H--N--K--R--S--K--I--K--P--D--E--D--L--P--S--P--G--A--R--G-
1441   GCAGCAGGAACAGCCCGAAGGAACAACCCTTGTCAAGGAGGAAGGGGACAAAGATGAAAG   1500
       -Q--Q--E--Q--P--E--G--T--T--L--V--K--E--E--G--D--K--D--E--S-
1501   CAAACAGGAGCCTGAAGTCATCTATGAGACAAACTGCCACTGGGAAGGCTGCGCGAGGGA   1560
       -K--Q--E--P--E--V--I--Y--E--T--N--C--H--W--E--G--C--A--R--E-
1561   GTTCGACACCCAAGAGCAGCTTGTGCACCATATAAATAACGACCATATTCATGGAGAGAA   1620
       -F--D--T--Q--E--Q--L--V--H--H--I--N--N--D--H--I--H--G--E--K-
1621   GAAGGAGTTCGTGTGCAGGTGGCTGGACTGCTCAAGAGAGCAGAAACCCTTCAAAGCCCA   1680
       -K--E--F--V--C--R--W--L--D--C--S--R--E--Q--K--P--F--K--A--Q-
1681   GTATATGTTGGTAGTGCATATGAGAAGACACACGGGCGAGAAGCCTCACAAATGCACTTT   1740
       -Y--M--L--V--V--H--M--R--R--H--T--G--E--K--P--H--K--C--T--F-
1741   TGAAGGTTGCACAAAGGCCTACTCGAGACTAGAAAACTTGAAAACACACTTGAGATCTCA   1800
       -E--G--C--T--K--A--Y--S--R--L--E--N--L--K--T--H--L--R--S--H-
1801   CACTGGAGAGAAACCATACGTCTGTGAGCACGAAGGTTGCAACAAGGCTTTCTCAAATGC   1860
       -T--G--E--K--P--Y--V--C--E--H--E--G--C--N--K--A--F--S--N--A-
1861   CTCTGATCGCGCCAAACACCAAAACAGAACGCATTCCAATGAGAAACCATATGTGTGCAA   1920
       -S--D--R--A--K--H--Q--N--R--T--H--S--N--E--K--P--Y--V--C--K-
1921   AATCCCAGGCTGCACTAAGCGTTACACAGACCCAAGCTCCCTCCGGAAACATGTGAAGAC   1980
       -I--P--G--C--T--K--R--Y--T--D--P--S--S--L--R--K--H--V--K--T-
1981   AGTGCATGGCCCAGAGGCTCATGTCACCAAGAAGCAGCGAGGGGACATCCATCCTCGGCC   2040
       -V--H--G--P--E--A--H--V--T--K--K--Q--R--G--D--I--H--P--R--P-
2041   GCCACCCCCGAGAGATTCCGGCAGCCATTCACAGTCCAGGTCGCCTGGCCGACCGACTCA   2100
       -P--P--P--R--D--S--G--S--H--S--Q--S--R--S--P--G--R--P--T--Q-
2101   GGGAGCCCTTGGTGAGCAGCAGGACCTCAGCAACACTACCTCAAAGCGGGAAGAATGCCT   2160
       -G--A--L--G--E--Q--Q--D--L--S--N--T--T--S--K--R--E--E--C--L-
2161   CCAGGTGAAAACCGTCAAGGCAGAGAAGCCAATGACATCTCAGCCAAGCCCTGGTGGTCA   2220
       -Q--V--K--T--V--K--A--E--K--P--M--T--S--Q--P--S--P--G--G--Q-
2221   GTCTTCATGCAGCAGCCAACAGTCCCCCATCAGCAACTATTCCAACAGTGGGCTCGAGCT   2280
       -S--S--C--S--S--Q--Q--S--P--I--S--N--Y--S--N--S--G--L--E--L-
2281   TCCTCTGACCGATGGAGGTAGTATAGGAGACCTCAGTGCCATCGATGAAACCCCAATCAT   2340
       -P--L--T--D--G--G--S--I--G--D--L--S--A--I--D--E--T--P--I--M-
2341   GGACTCAACCATTTCCACTGCAACCACAGCCCTTGCTTTGCAAGCCAGGAGAAACCCGGC   2400
       -D--S--T--I--S--T--A--T--T--A--L--A--L--Q--A--R--R--N--P--A-
2401   AGGGACCAAATGGATGGAGCACGTAAAACTAGAAAGGCTAAAACAAGTGAATGGAATGTT   2460
       -G--T--K--W--M--E--H--V--K--L--E--R--L--K--Q--V--N--G--M--F-
2461   TCCGCGACTGAACCCCATTCTACCCCCTAAAGCCCCTGCGGTCTCTCCTCTCATAGGAAA   2520
       -P--R--L--N--P--I--L--P--P--K--A--P--A--V--S--P--L--I--G--N-
2521   TGGCACACAGTCCAACAACACCTGCAGCTTGGGTGGGCCCATGACGCTTCTCCCGGGCAG   2580
       -G--T--Q--S--N--N--T--C--S--L--G--G--P--M--T--L--L--P--G--R-
2581   AAGCGACCTCTCTGGGGTGGACGTCACTATGCTGAACATGCTCAACAGAAGGGACAGCAG   2640
       -S--D--L--S--G--V--D--V--T--M--L--N--M--L--N--R--R--D--S--S-
2641   CGCCAGCACCATCAGCTCGGCCTACCTGAGCAGCCGCCGCTCCTCAGGGATCTCGCCCTG   2700
       -A--S--T--I--S--S--A--Y--L--S--S--R--R--S--S--G--I--S--P--C-
2701   CTTCTCCAGCCGCCGCTCCAGCGAGGCGTCACAGGCCGAGGGCCGGCCGCAGAACGTGAG   2760
       -F--S--S--R--R--S--S--E--A--S--Q--A--E--G--R--P--Q--N--V--S-
2761   CGTGGCCGACTCCTACGACCCCATCTCCACCGACGCCTCGCGCCGCTCCAGCGAAGCCAG   2820
       -V--A--D--S--Y--D--P--I--S--T--D--A--S--R--R--S--S--E--A--S-
2821   CCAGAGCGACGGCCTGCCCAGCCTGCTCAGCCTCACGCCCGCCCAGCAGTACCGCCTCAA   2880
       -Q--S--D--G--L--P--S--L--L--S--L--T--P--A--Q--Q--Y--R--L--K-
2881   GGCCAAGTACGCGGCTGCCACAGGAGGGCCGCCGCCGACGCCCCTGCCCAACATGGAGAG   2940
       -A--K--Y--A--A--A--T--G--G--P--P--P--T--P--L--P--N--M--E--R-
2941   GATGAGCCTGAAGACGCGCCTGGCGCTGCTCGGGGATGCCCTCGAGCCTGGCGTGGCCCT   3000
       -M--S--L--K--T--R--L--A--L--L--G--D--A--L--E--P--G--V--A--L-
3001   GCCTCCAGTTCATGCCCCGAGGAGGTGCAGCGACGGGGGAGCCCACGGCTACGGGCGGCG   3060
       -P--P--V--H--A--P--R--R--C--S--D--G--G--A--H--G--Y--G--R--R-
3061   CCACCTGCAGCCGCACGATGCGCCGGGCCACGGCGTGAGGAGGGCCAGCGACCCGGTGCG   3120
       -H--L--Q--P--H--D--A--P--G--H--G--V--R--R--A--S--D--P--V--R-
3121   GACAGGCTCCGAGGGCCTGGCCCTGCCTCGTGTGCCGCGCTTCAGCAGCCTCAGCAGCTG   3180
       -T--G--S--E--G--L--A--L--P--R--V--P--R--F--S--S--L--S--S--C-
3181   CAACCCCCCGGCGATGGCCACGTCCGCGGAGAAGCGCAGTCTCGTGCTTCAGAATTACAC   3240
       -N--P--P--A--M--A--T--S--A--E--K--R--S--L--V--L--Q--N--Y--T-
3241   GCGGCCCGAGGGCGGCCAGTCCCGAAACTTCCACTCGTCCCCCTGTCCTCCCAGCATCAC   3300
       -R--P--E--G--G--Q--S--R--N--F--H--S--S--P--C--P--P--S--I--T-
3301   CGAGAACGTCACCCTGGAGTCCCTGACCATGGACGCTGATGCCAACCTGAACGATGAGGA   3360
       -E--N--V--T--L--E--S--L--T--M--D--A--D--A--N--L--N--D--E--D-
3361   TTTCCTGCCGGACGACGTGGTGCAGTATTTAAATTCCCAGAACCAAGCAGGGTACGAGCA   3420
       -F--L--P--D--D--V--V--Q--Y--L--N--S--Q--N--Q--A--G--Y--E--Q-
3421   GCACTTCCCCAGCGCCCTCCCGGACGACAGCAAAGTGCCCCACGGGCCCGGTGACTTTGA   3480
       -H--F--P--S--A--L--P--D--D--S--K--V--P--H--G--P--G--D--F--D-
3481   CGCGCCCGGGCTGCCAGACAGCCACGCTGGCCAGCAGTTCCATGCCCTCGAGCAGCCCTG   3540
       -A--P--G--L--P--D--S--H--A--G--Q--Q--F--H--A--L--E--Q--P--C-
3541   CCCCGAGGGCAGCAAAACCGACCTGCCCATTCAGTGGAACGAAGTCAGCTCCGGAAGCGC   3600
       -P--E--G--S--K--T--D--L--P--I--Q--W--N--E--V--S--S--G--S--A-
3601   CGACCTGTCCTCCTCCAAGCTCAAGTGTGGGCCGCGGCCCGCTGTGCCGCAGACTCGCGC   3660
       -D--L--S--S--S--K--L--K--C--G--P--R--P--A--V--P--Q--T--R--A-
3661   CTTTGGGTTCTGCAACGGCATGGTCGTCCACCCGCAGAACCCCTTGAGGAGCGGGCCTGC   3720
       -F--G--F--C--N--G--M--V--V--H--P--Q--N--P--L--R--S--G--P--A-
3721   TGGGGGCTATCAGACCCTCGGGGAGAACAGCAACCCCTACGGTGGCCCAGAGCACTTGAT   3780
       -G--G--Y--Q--T--L--G--E--N--S--N--P--Y--G--G--P--E--H--L--M-
3781   GCTCCACAACAGCCCCGGAAGTGGCACCAGTGGAAACGCCTTCCATGAACAGCCCTGTAA   3840
       -L--H--N--S--P--G--S--G--T--S--G--N--A--F--H--E--Q--P--C--K-
3841   GGCCCCGCAGTATGGGAACTGTCTCAACAGGCAGCCAGTGGCCCCTGGTGCACTCGACGG   3900
       -A--P--Q--Y--G--N--C--L--N--R--Q--P--V--A--P--G--A--L--D--G-
3901   TGCCTGTGGTGCCGGGATTCAAGCCTCAAAGCTGAAGAGCACCCCCATGCAAGGGAGCGG   3960
       -A--C--G--A--G--I--Q--A--S--K--L--K--S--T--P--M--Q--G--S--G-
3961   GGGCCAGCTGAATTTCGGCCTGCCGGTAGCGCCAAATGAGTCAGCTGGCAGCATGGTGAA   4020
       -G--Q--L--N--F--G--L--P--V--A--P--N--E--S--A--G--S--M--V--N-
4021   TGGCATGCAGAACCAGGACCCAGTGGGACAGGGGTACCTGGCTCACCAGCTCCTCGGCGA   4080
       -G--M--Q--N--Q--D--P--V--G--Q--G--Y--L--A--H--Q--L--L--G--D-
4081   CAGCATGCAGCACCCGGGGGCAGGCCGCCCCGGTCAGCAGATGCTTGGGCAGATTAGTGC   4140
       -S--M--Q--H--P--G--A--G--R--P--G--Q--Q--M--L--G--Q--I--S--A-
4141   TACCTCACACATCAACATCTACCAAGGGCCAGAGAGCTGCCTGCCAGGGGCTCACGGCAT   4200
       -T--S--H--I--N--I--Y--Q--G--P--E--S--C--L--P--G--A--H--G--M-
4201   GGGCAGCCAGCCGTCAAGCTTGGCAGTTGTCAGGGGCTACCAGCCATGTGCCAGCTTTGG   4260
       -G--S--Q--P--S--S--L--A--V--V--R--G--Y--Q--P--C--A--S--F--G-
4261   GGGCAGCAGGCGCCAGGCTATGCCGAGGGACAGCCTTGCTCTGCAGTCAGGACAGCTCAG   4320
       -G--S--R--R--Q--A--M--P--R--D--S--L--A--L--Q--S--G--Q--L--S-
4321   TGACACAAGTCAGACCTGCAGGGTGAATGGTATCAAGATGGAGATGAAAGGGCAGCCCCA   4380
       -D--T--S--Q--T--C--R--V--N--G--I--K--M--E--M--K--G--Q--P--H-
4381   TCCGCTGTGCTCTAATCTGCAGAATTACTCTGGTCAGTTCTATGACCAAACCGTGGGCTT   4440
       -P--L--C--S--N--L--Q--N--Y--S--G--Q--F--Y--D--Q--T--V--G--F-
4441   CAGTCAGCAAGACACGAAAGCTGGTTCATTCTCTATTTCAGACGCCAGCTGCCTGCTACA   4500
       -S--Q--Q--D--T--K--A--G--S--F--S--I--S--D--A--S--C--L--L--Q-
4501   GGGGACCAGCGCCAAAAACTCTGAGTTACTTTCCCCAGGTGCTAATCAGGTGACAAGCAC   4560
       -G--T--S--A--K--N--S--E--L--L--S--P--G--A--N--Q--V--T--S--T-
4561   AGTGGACAGCCTCGACAGCCATGACCTGGAAGGGGTACAGATTGACTTCGATGCCATCAT   4620
       -V--D--S--L--D--S--H--D--L--E--G--V--Q--I--D--F--D--A--I--I-
4621   AGACGATGGGGACCACTCCAGCCTGATGTCGGGGGCCCTGAGCCCAAGTATCATTCAGAA   4680
       -D--D--G--D--H--S--S--L--M--S--G--A--L--S--P--S--I--I--Q--N-
4681   CCTTTCCCATAGCTCCTCCCGCCTCACCACGCCTCGGGCGTCCCTCCCATTCCCAGCGCT   4740
       -L--S--H--S--S--S--R--L--T--T--P--R--A--S--L--P--F--P--A--L-
4741   GTCCATGAGCACCACCAACATGGCTATCGGGGACATGAGTTCTTTGCTGACCTCCCTAGC   4800
       -S--M--S--T--T--N--M--A--I--G--D--M--S--S--L--L--T--S--L--A-
4801   GGAAGAAAGCAAATTCCTTGCAGTTATGCAATAGgctttaggaaaaaaagactgcaacca   4860
       -E--E--S--K--F--L--A--V--M--Q--***..........................
4861   acggaaatcaataggagttgaagagattaaactgactttgttttggctgtttttttagtt   4920
       ............................................................
4921   ctgtatgtattttagcaatctcatctcacctaactgagatgtgtttcaattatattcctt   4980
       ............................................................
4981   ttatggaaaaggactctgaaaaaccctaaagtattctagggagaaactgtcttccatttc   5040
       ............................................................
5041   agttttgaatcagtattgttacactcaaaccaccctctttttaaaaaaaaaaaaaaaaac   5100
       ............................................................
5101   tgtaagccccgccccctttttagtaaaccgatgtaaatttgtgatgtgcatattcttctt   5160
       ............................................................
5161   tcttttagaagagcagtcaaattaaaggatttgacatgttttgctgttgctcaaaggaaa   5220
       ............................................................
5221   taggagttggtgtgcttgtgaccaaggggttacacttccagcttttaaaattctccttta   5280
       ............................................................
5281   catgtgctcagtgttttgttttgtgttttggtttctgttttttattttaattcccacatt   5340
       ............................................................
5341   gggcacaagaatcagaatatggatagctagtttaagaaacttttgtgggtgcactgtagc   5400
       ............................................................
5401   atagatgacagaatattgatgttccccccatctccaattcagttcagggcattccacagt   5460
       ............................................................
5461   taaacagaaatgggaacgtggggctcttataaatgaaatgggcgctcacagttttggttt   5520
       ............................................................
5521   tcagctcttcatgtctgtaagtgtgctttgggggaggctatgtctgtatggtcgattctc   5580
       ............................................................
5581   agttatcacatttgcctctcctcccactaccttcatgaacattcagtgctgtttcgcact   5640
       ............................................................
5641   gcagttagagagaagggacggacagttggtgacactcagccacattgctacttttatctg   5700
       ............................................................
5701   ttctggtaagaagttagatagatggtagattgaagcaattgggtagaattagttggggga   5760
       ............................................................
5761   atatttatgagttgctgtgtttgttgattagttccatctctttcccattttaactgagaa   5820
       ............................................................
5821   ttgattatatatagctctaagtatataggtatttaaacaaccccacaagcggctgtatca   5880
       ............................................................
5881   gtaacatttattaattccactatagtgagggaggatttccattctaaataccttattttg   5940
       ............................................................
5941   agggatttataaaacttagttgtaaaagagaaagcccacatagtgggaataaattgcttc   6000
       ............................................................
6001   agccatttttagtatttgagagcactagggaagatgtttagtagctgtgtggatgccttt   6060
       ............................................................
6061   tttcacaccctgtctattgaatgctgcatccattcacgaagttaaatgttacatgcagtt   6120
       ............................................................
6121   agtccttaatgtggactggatctgtacttttgttttggattaaaacatttaaagattttt   6180
       ............................................................
6181   gaagtgcagctactccccacgtgcatttgatacacataaaagtcatactgtgtgtgcaca   6240
       ............................................................
6241   aagagtacatggattttccagcatattgctttaaaaaattatataaactgttaaaatatt   6300
       ............................................................
6301   aacacctcaggctacctgctgtattctgtcccattgacccctggaattggatttactgca   6360
       ............................................................
6361   agtgattgataattcaattatgtggcttttcccctttaatcttgccatttaaattacagt   6420
       ............................................................
6421   agaaagacaaaatcaagtaaaataaagtgttagataatagaaagagtgttaagaccagcc   6480
       ............................................................
6481   cacttttctcatgtttatgttctttcatttggaccaagaatctccgcatggaggttgatt   6540
       ............................................................
6541   tgccactggggactttggctaagactattaggtttgctttcaactagatgttcctgagac   6600
       ............................................................
6601   aagcagagggacactgcaattccccttccatgcctgctgttctcccccatgtaagtcttc   6660
       ............................................................
6661   tttgaaattaacggatgtgtctcctttggaacagccccataacaaaagagaactactgat   6720
       ............................................................
6721   ctgagcataggaaagtagaggctctaccacttttcagttgaaaaagcaagactttctctg   6780
       ............................................................
6781   tgtttctgaaacaaggcataatgttgtcacagaatcagagatccagtctcacttttccac   6840
       ............................................................
6841   aaatctccaaatctccagtcttatcttgtgtgctctaatggtttggttcaatccctttcc   6900
       ............................................................
6901   aactcttgttttcaaagcatggggcctgagtgttctccactcctcctaagaaaggagctt   6960
       ............................................................
6961   gggtggaagggaccatgctgacctcctccatcagagggctcttccagtagtattctcgga   7020
       ............................................................
7021   tgcaacctccatttctcagttaccattatttcctgtatcagctttgtccttcctggaggg   7080
       ............................................................
7081   atgcacagtgatccggcccaccactgttgttgtcttgtgcttctgctctttcctatggtt   7140
       ............................................................
7141   tcaggttattttctgggtttcccctattcttcttttatttctttttttttttatatttgc   7200
       ............................................................
7201   tttcctttctactgcttttagatttgcaggagatgcaagtttcagctcaatgtttggctt   7260
       ............................................................
7261   ctctcaatatggaaatttcagaaggacagaggagaggagggaggaagaagaaagtatact   7320
       ............................................................
7321   cctccagaatttcagtgatctgttgtggcagtccagtggaaggaaggtcttttgaggtca   7380
       ............................................................
7381   cttagaagcatctttttgggacatccttttgggatctctgtaggctaggcatctcatatc   7440
       ............................................................
7441   ttgagactcacccccagcctccaagcctctctccatttctctaacctatgcattttagag   7500
       ............................................................
7501   cgagaggaccgcctcactagtgtcaccatcctgccttttctaaaacatgcaggctcacac   7560
       ............................................................
7561   attctactcctgcttaatgtctgtgttaaacgttttctaaccatttttgttttatttttc   7620
       ............................................................
7621   tgaaaaagttaacccctcccaactcctcacacattggctcttcctcttgagccacaaagt   7680
       ............................................................
7681   tttgattcttgcgatgtatgtgccttattttatgttaatcttgtcaatgagagggaccag   7740
       ............................................................
7741   ttggtgttgcccaatcagcactccaaggctgtgtgtgcaccagccagagagcgcacggtg   7800
       ............................................................
7801   gtagcagagtcgaggctgtcttgtatcctggtttcatgtgttgttttgaactgataggag   7860
       ............................................................
7861   gatgttctcttctgacaagttacccttgtgtatcctgcagacatgtaaaataaaatacaa   7920
       ............................................................
7921   gttcatttttttcaccttttttagatttttttaaaaaataaaatgtgtaatccttttttt   7980
       ............................................................
7981   aaaagaaacacatgtaaatacatttaagtattgtaggcatagcgttcagatgtgactggc   8040
       ............................................................
8041   ccaggcgttcctcggacaagcctgcattccccgtgatcacgcccacctcaagcccagggg   8100
       ............................................................
8101   ctgcagcccagccacagatgaactctacctttgctttcagaaccacttagtccttttgta   8160
       ............................................................
8161   acaaagaaaaaaaaatgtttcttacaatgtcaataaaaaattctttgtatggaaaaaaaa   8220
       ............................................................
8221   aaaaaaaa                                                       8280
       ........