Imprinted Gene Databases

Homo sapiens: DIRAS3

DIRAS family, GTP-binding RAS-like 3
Species Gene Aliases Location Status Expressed Allele
Homo sapiens DIRAS3 ARHI, NOEY2  1p31  Imprinted Paternal
Sus scrofa DIRAS3   Imprinted Biallelic
1      gctctgcgttgggccagcccctcacagctggtttcttaccacgtattgcgcaagcggaat     60
       ............................................................
61     ctatgcctgttacccacactccctgcgcccccgcaccccgctcctgtgcgcaagtcggaa    120
       ............................................................
121    tataaaaccgcggaggagtgagctcttggggtgtccagttggttgccgcggcagtctctc    180
       ............................................................
181    cgagcagcgcatttgtcttctaggctgcttggttcgtgcctccgagaaaggggtctcctg    240
       ............................................................
241    ctgccagctaagtgtgggagaacttgtgcacgtatctcccctccgaatcccaacgATGGG    300
       .......................................................M--G-
301    TAACGCCAGCTTTGGCTCCAAGGAACAGAAGCTGCTGAAGCGGTTGCGGCTTCTGCCCGC    360
       -N--A--S--F--G--S--K--E--Q--K--L--L--K--R--L--R--L--L--P--A-
361    CCTGCTTATCCTCCGCGCCTTCAAGCCCCACAGGAAGATCAGAGATTACCGCGTCGTGGT    420
       -L--L--I--L--R--A--F--K--P--H--R--K--I--R--D--Y--R--V--V--V-
421    AGTCGGCACCGCTGGTGTGGGGAAAAGTACGCTGCTGCACAAGTGGGCGAGCGGCAACTT    480
       -V--G--T--A--G--V--G--K--S--T--L--L--H--K--W--A--S--G--N--F-
481    CCGTCATGAGTACCTGCCGACCATTGAAAATACCTACTGCCAGTTGCTGGGCTGCAGCCA    540
       -R--H--E--Y--L--P--T--I--E--N--T--Y--C--Q--L--L--G--C--S--H-
541    CGGTGTGCTTTCCCTGCACATCACCGACAGCAAGAGTGGCGACGGCAACCGCGCTCTGCA    600
       -G--V--L--S--L--H--I--T--D--S--K--S--G--D--G--N--R--A--L--Q-
601    GCGCCACGTTATAGCCCGGGGCCACGCCTTCGTCCTGGTCTACTCAGTCACCAAGAAGGA    660
       -R--H--V--I--A--R--G--H--A--F--V--L--V--Y--S--V--T--K--K--E-
661    AACCCTGGAAGAGCTGAAGGCCTTCTATGAGCTGATCTGCAAGATCAAAGGTAACAACCT    720
       -T--L--E--E--L--K--A--F--Y--E--L--I--C--K--I--K--G--N--N--L-
721    GCATAAGTTCCCCATCGTGCTGGTGGGCAATAAAAGTGATGACACCCACCGGGAGGTGGC    780
       -H--K--F--P--I--V--L--V--G--N--K--S--D--D--T--H--R--E--V--A-
781    CCTGAATGATGGTGCCACCTGTGCGATGGAGTGGAATTGCGCCTTCATGGAGATTTCAGC    840
       -L--N--D--G--A--T--C--A--M--E--W--N--C--A--F--M--E--I--S--A-
841    CAAGACCGATGTGAATGTGCAGGAGCTGTTCCACATGCTGCTGAATTACAAGAAAAAGCC    900
       -K--T--D--V--N--V--Q--E--L--F--H--M--L--L--N--Y--K--K--K--P-
901    CACCACCGGCCTCCAGGAGCCCGAGAAGAAATCCCAGATGCCCAACACCACTGAGAAGCT    960
       -T--T--G--L--Q--E--P--E--K--K--S--Q--M--P--N--T--T--E--K--L-
961    GCTTGACAAGTGCATAATCATGTGAgccctgggccttaagagccagctcttcctatcctg   1020
       -L--D--K--C--I--I--M--***...................................
1021   tagcgtgtagaaaacgtggactcatttcactatgttacatgtacatggttgattttgtgc   1080
       ............................................................
1081   tgttgtttggactgtaacatccatgttgtcaatacgtataccttgtaagtggataacttt   1140
       ............................................................
1141   tctttttcccaggccagagaattcaaattgttaaaacattggcatttgaagaggagaaca   1200
       ............................................................
1201   aaatgtagcatgatgtatttaaagtaaggcctttagtaatgaatgtaatgagagaaaatg   1260
       ............................................................
1261   ttttgaaaagaacaaaacatcaaaatgaatagaaagaaaaattggaaggcgtccttttgg   1320
       ............................................................
1321   taacccgattattgtgtattacctttaaatatttcacatcctgtaagtgcttaatcatat   1380
       ............................................................
1381   cttttaattgtgtatttaagaaaagtgttttcacaacaaaagcttttgataaattgctgc   1440
       ............................................................
1441   gtgacatatactaaataaaaaaatgaatatgttgatcattaggggtgtgggagcagagaa   1500
       ............................................................
1501   aattgtgaaagtgactctcactaaagatgttagtagtttctcatgtcatttaaaaatgtt   1560
       ............................................................
1561   tgagtattctgcatagcagtttgtaaaagtgtaacagcttattgacttaataaagctttt   1620
       ............................................................
1621   cctgcatgcaaaaaaaaaaaaa                                         1680
       ......................