Imprinted Gene Databases

Homo sapiens: DIRAS3

DIRAS family, GTP-binding RAS-like 3
Species Gene Aliases Location Status Expressed Allele
Sus scrofa DIRAS3   Imprinted Biallelic
Homo sapiens DIRAS3 ARHI, NOEY2  1p31  Imprinted Paternal
1      gctctgcgttgggccagcccctcacagctggtttcttaccacgtattgcgcaagcggaat     60
61     ctatgcctgttacccacactccctgcgcccccgcaccccgctcctgtgcgcaagtcggaa    120
121    tataaaaccgcggaggagtgagctcttggggtgtccagttggttgccgcggcagtctctc    180
181    cgagcagcgcatttgtcttctaggctgcttggttcgtgcctccgagaaaggggtctcctg    240
241    ctgccagctaagtgtgggagaacttgtgcacgtatctcccctccgaatcccaacgATGGG    300
961    GCTTGACAAGTGCATAATCATGTGAgccctgggccttaagagccagctcttcctatcctg   1020
1021   tagcgtgtagaaaacgtggactcatttcactatgttacatgtacatggttgattttgtgc   1080
1081   tgttgtttggactgtaacatccatgttgtcaatacgtataccttgtaagtggataacttt   1140
1141   tctttttcccaggccagagaattcaaattgttaaaacattggcatttgaagaggagaaca   1200
1201   aaatgtagcatgatgtatttaaagtaaggcctttagtaatgaatgtaatgagagaaaatg   1260
1261   ttttgaaaagaacaaaacatcaaaatgaatagaaagaaaaattggaaggcgtccttttgg   1320
1321   taacccgattattgtgtattacctttaaatatttcacatcctgtaagtgcttaatcatat   1380
1381   cttttaattgtgtatttaagaaaagtgttttcacaacaaaagcttttgataaattgctgc   1440
1441   gtgacatatactaaataaaaaaatgaatatgttgatcattaggggtgtgggagcagagaa   1500
1501   aattgtgaaagtgactctcactaaagatgttagtagtttctcatgtcatttaaaaatgtt   1560
1561   tgagtattctgcatagcagtttgtaaaagtgtaacagcttattgacttaataaagctttt   1620
1621   cctgcatgcaaaaaaaaaaaaa                                         1680