Imprinted Gene Databases

Sus scrofa: IGF2

Insulin-like growth factor 2

Li et al. Anim. Biotechnol. 19:22-27, 2008

Species Gene Aliases Location Status Expressed Allele
Bos taurus IGF2 IGF2, MGC140034  29qter  Imprinted Paternal
Homo sapiens IGF2 INSIGF, pp9974, C11orf43, FLJ22066, FLJ44734  11p15.5  Imprinted Paternal
Mus musculus Igf2 Mpr, M6pr, Peg2, Igf-2, Igf-II, AL033362  7 69.09 cM  Imprinted Paternal
Ovis aries IGF2 IGF2, IGF-II  21  Imprinted Paternal
Rattus norvegicus Igf2 IGFII, RNIGF2  1q41  Imprinted Paternal
Sus scrofa IGF2 IGF-II  2p  Imprinted Paternal
Didelphis virginiana IGF2     Imprinted Paternal
Ornithorhynchus anatinus IGF2     Not Imprinted Biallelic
Tachyglossus aculeatus IGF2     Not Imprinted Biallelic
Gallus gallus domesticus IGF2 IGF-II  Not Imprinted Biallelic
Osteichthyes IGF2     Not Imprinted Biallelic
Macropus eugenii IGF2     Imprinted Paternal
1      cggggcgggtggccggccggacactggacccggaaggggggtaggcggctgggatgagtg     60
       ............................................................
61     gcgagctgtccatgggagcacccagcggccccattggcaccagtacaggcaggggcacct    120
       ............................................................
121    gcagcagctgaggggccgaagagtcacccctgaacttgaggacgagcagccggattccag    180
       ............................................................
181    cccccagccccagggccccacatctcctcgggctcagccgcgcgccccagctgcccccca    240
       ............................................................
241    gcctgagctgcagcaggccagggctgcccgagaccccagcccccaggtgagctgctgcag    300
       ............................................................
301    cctgtggcccaggagatctccgccggctcagaactgaggcgggcagcccacccagcccac    360
       ............................................................
361    agcgattccaATGGGGATCCCGATGAGGAAGCCGCTGCTCGTGCTGCTCGTCTTCTTGGC    420
       ..........M--G--I--P--M--R--K--P--L--L--V--L--L--V--F--L--A-
421    CTTGGCCTCGTGCTGCTATGCTGCTTACCGCCCCAGTGAGACTCTGTGCGGCGGGGAGCT    480
       -L--A--S--C--C--Y--A--A--Y--R--P--S--E--T--L--C--G--G--E--L-
481    GGTGGACACCCTCCAGTTTGTCTGCGGGGACCGCGGCTTCTACTTCAGCAGGCCGGCAAG    540
       -V--D--T--L--Q--F--V--C--G--D--R--G--F--Y--F--S--R--P--A--S-
541    CCGCGTGAACCGCCGCAGCCGTGGCATCGTGGAAGAGTGCTGCTTCCGTAGCTGCGACCT    600
       -R--V--N--R--R--S--R--G--I--V--E--E--C--C--F--R--S--C--D--L-
601    GGCCCTGCTGGAGACCTACTGCGCCACCCCCGCCAAGTCCGAGAGGGACGTGTCGACCCC    660
       -A--L--L--E--T--Y--C--A--T--P--A--K--S--E--R--D--V--S--T--P-
661    TCCGACCGTGCTTCCGGACAACTTCCCCAGATACCCCGTGGGCAAGTTCTTCCGCTATGA    720
       -P--T--V--L--P--D--N--F--P--R--Y--P--V--G--K--F--F--R--Y--D-
721    CACCTGGAAGCAGTCCGCCCAACGCCTGCGCAGGGGCCTGCCGGCCCTCCTGCGCGCCCG    780
       -T--W--K--Q--S--A--Q--R--L--R--R--G--L--P--A--L--L--R--A--R-
781    CCGGGGTCGCACGCTCGCCAAGGAGCTGGAGGCGGTCAGAGAGGCCAAGCGTCACCGACC    840
       -R--G--R--T--L--A--K--E--L--E--A--V--R--E--A--K--R--H--R--P-
841    CCTGACCGCCCGTCCCACCCGAGACCCCGCCGCCCACGGGGGCGCCTCTCCCGAGGCGTC    900
       -L--T--A--R--P--T--R--D--P--A--A--H--G--G--A--S--P--E--A--S-
901    CGGCCATCGGAAGTGAgccaaattgtcgtaattctgcggtgccaccatccacctcgtgac    960
       -G--H--R--K--***............................................
961    ctcctctcgaccgggaccgcttccatcaggtcccccttctgagatctctgtacccttctg   1020
       ............................................................
1021   tctgcgggcatctccgccccgggccccgtgccccaacctccccatgtcaggctagtctct   1080
       ............................................................
1081   cctcggccccttccatcgggccgagggcatccaaaccacaaacccaattggcttggtctg   1140
       ............................................................
1141   tatctccccccaaattatgcccccaattatccccaagttacataccaaaaattgaacccc   1200
       ............................................................
1201   tcaaccacacccacataccatcacg                                      1260
       .........................