Imprinted Gene Databases

Sus scrofa: IGF2

Insulin-like growth factor 2

Li et al. Anim. Biotechnol. 19:22-27, 2008

Species Gene Aliases Location Status Expressed Allele
Mus musculus Igf2 Mpr, M6pr, Peg2, Igf-2, Igf-II, AL033362  7 69.09 cM  Imprinted Paternal
Bos taurus IGF2 IGF2, MGC140034  29qter  Imprinted Paternal
Tachyglossus aculeatus IGF2     Not Imprinted Biallelic
Sus scrofa IGF2 IGF-II  2p  Imprinted Paternal
Gallus gallus domesticus IGF2 IGF-II  Not Imprinted Biallelic
Rattus norvegicus Igf2 IGFII, RNIGF2  1q41  Imprinted Paternal
Ornithorhynchus anatinus IGF2     Not Imprinted Biallelic
Ovis aries IGF2 IGF2, IGF-II  21  Imprinted Paternal
Osteichthyes IGF2     Not Imprinted Biallelic
Homo sapiens IGF2 INSIGF, pp9974, C11orf43, FLJ22066, FLJ44734  11p15.5  Imprinted Paternal
Macropus eugenii IGF2     Imprinted Paternal
Didelphis virginiana IGF2     Imprinted Paternal
1      cggggcgggtggccggccggacactggacccggaaggggggtaggcggctgggatgagtg     60
       ............................................................
61     gcgagctgtccatgggagcacccagcggccccattggcaccagtacaggcaggggcacct    120
       ............................................................
121    gcagcagctgaggggccgaagagtcacccctgaacttgaggacgagcagccggattccag    180
       ............................................................
181    cccccagccccagggccccacatctcctcgggctcagccgcgcgccccagctgcccccca    240
       ............................................................
241    gcctgagctgcagcaggccagggctgcccgagaccccagcccccaggtgagctgctgcag    300
       ............................................................
301    cctgtggcccaggagatctccgccggctcagaactgaggcgggcagcccacccagcccac    360
       ............................................................
361    agcgattccaATGGGGATCCCGATGAGGAAGCCGCTGCTCGTGCTGCTCGTCTTCTTGGC    420
       ..........M--G--I--P--M--R--K--P--L--L--V--L--L--V--F--L--A-
421    CTTGGCCTCGTGCTGCTATGCTGCTTACCGCCCCAGTGAGACTCTGTGCGGCGGGGAGCT    480
       -L--A--S--C--C--Y--A--A--Y--R--P--S--E--T--L--C--G--G--E--L-
481    GGTGGACACCCTCCAGTTTGTCTGCGGGGACCGCGGCTTCTACTTCAGCAGGCCGGCAAG    540
       -V--D--T--L--Q--F--V--C--G--D--R--G--F--Y--F--S--R--P--A--S-
541    CCGCGTGAACCGCCGCAGCCGTGGCATCGTGGAAGAGTGCTGCTTCCGTAGCTGCGACCT    600
       -R--V--N--R--R--S--R--G--I--V--E--E--C--C--F--R--S--C--D--L-
601    GGCCCTGCTGGAGACCTACTGCGCCACCCCCGCCAAGTCCGAGAGGGACGTGTCGACCCC    660
       -A--L--L--E--T--Y--C--A--T--P--A--K--S--E--R--D--V--S--T--P-
661    TCCGACCGTGCTTCCGGACAACTTCCCCAGATACCCCGTGGGCAAGTTCTTCCGCTATGA    720
       -P--T--V--L--P--D--N--F--P--R--Y--P--V--G--K--F--F--R--Y--D-
721    CACCTGGAAGCAGTCCGCCCAACGCCTGCGCAGGGGCCTGCCGGCCCTCCTGCGCGCCCG    780
       -T--W--K--Q--S--A--Q--R--L--R--R--G--L--P--A--L--L--R--A--R-
781    CCGGGGTCGCACGCTCGCCAAGGAGCTGGAGGCGGTCAGAGAGGCCAAGCGTCACCGACC    840
       -R--G--R--T--L--A--K--E--L--E--A--V--R--E--A--K--R--H--R--P-
841    CCTGACCGCCCGTCCCACCCGAGACCCCGCCGCCCACGGGGGCGCCTCTCCCGAGGCGTC    900
       -L--T--A--R--P--T--R--D--P--A--A--H--G--G--A--S--P--E--A--S-
901    CGGCCATCGGAAGTGAgccaaattgtcgtaattctgcggtgccaccatccacctcgtgac    960
       -G--H--R--K--***............................................
961    ctcctctcgaccgggaccgcttccatcaggtcccccttctgagatctctgtacccttctg   1020
       ............................................................
1021   tctgcgggcatctccgccccgggccccgtgccccaacctccccatgtcaggctagtctct   1080
       ............................................................
1081   cctcggccccttccatcgggccgagggcatccaaaccacaaacccaattggcttggtctg   1140
       ............................................................
1141   tatctccccccaaattatgcccccaattatccccaagttacataccaaaaattgaacccc   1200
       ............................................................
1201   tcaaccacacccacataccatcacg                                      1260
       .........................