Imprinted Gene Databases

Sus scrofa: DLX5

Distal-less homeobox 5
Species Gene Aliases Location Status Expressed Allele
Homo sapiens DLX5   7q22  Imprinted Maternal
Mus musculus Dlx5 AI385752  6 2.0 cM  Not Imprinted Biallelic
Sus scrofa DLX5     Imprinted Maternal
1      ATGACAGGGGTGTTTGACAGGAGGGTCCCCAGCATCCGATCCGGCGACTTCCAAGCCCCG     60
       M--T--G--V--F--D--R--R--V--P--S--I--R--S--G--D--F--Q--A--P--
61     TTCCAGACGTCCGCAGCCATGCACCATCCGTCTCAGGAATCGCCAACTTTGCCCGAGTCG    120
       F--Q--T--S--A--A--M--H--H--P--S--Q--E--S--P--T--L--P--E--S--
121    TCGGCTACCGATTCCGACTACTACAGCCCCACGGGGGGAGCCCCGCACGGCTACTGCTCT    180
       S--A--T--D--S--D--Y--Y--S--P--T--G--G--A--P--H--G--Y--C--S--
181    CCTACCTCGGCTTCCTACGGGAAAGCGCTCGACCCCTACCAGTACCAGTACCCCGGCGTG    240
       P--T--S--A--S--Y--G--K--A--L--D--P--Y--Q--Y--Q--Y--P--G--V--
241    AGCGGCTCCGCCGGCAGCTATCCCGCCAAAGCTTACGCCGACTACAGCTACGCCAGCCCC    300
       S--G--S--A--G--S--Y--P--A--K--A--Y--A--D--Y--S--Y--A--S--P--
301    TATCACCAGTACGGCGGCGCCTACAACCGCGTCCCGAGCGCCACCAGCCAGCCAGAGAAA    360
       Y--H--Q--Y--G--G--A--Y--N--R--V--P--S--A--T--S--Q--P--E--K--
361    GAAGTGGCCGAGCCCGAGGTGAGAATGGTGAACGGCAAACCAAAGAAAGTTCGTAAACCC    420
       E--V--A--E--P--E--V--R--M--V--N--G--K--P--K--K--V--R--K--P--
421    AGGACTATTTATTCCAGCTTTCAGCTGGCCGCGTTACAGAGAAGGTTTCAGAAGACTCAG    480
       R--T--I--Y--S--S--F--Q--L--A--A--L--Q--R--R--F--Q--K--T--Q--
481    TACCTCGCCCTGCCCGAACGCGCCGAGCTGGCCGCCTCGCTGGGACTGACGCAAACACAG    540
       Y--L--A--L--P--E--R--A--E--L--A--A--S--L--G--L--T--Q--T--Q--
541    GTGAAAATCTGGTTTCAGAACAAAAGATCCAAGATCAAGAAGATAATGAAAAACGGGGAG    600
       V--K--I--W--F--Q--N--K--R--S--K--I--K--K--I--M--K--N--G--E--
601    ATGCCCCCGGAGCACAGCCCCAGCTCCAGCGACCCCATGGCGTGTAACTCGCCGCAGTCT    660
       M--P--P--E--H--S--P--S--S--S--D--P--M--A--C--N--S--P--Q--S--
661    CCGGCTGTGTGGGAGCCCCAGGGTTCGTCCCGCTCGCTCAGCCACCACCCTCATGCCCAC    720
       P--A--V--W--E--P--Q--G--S--S--R--S--L--S--H--H--P--H--A--H--
721    CCTCCGACCTCCAACCAGTCCCCCGCGTCCAGCTACCTGGAGAACTCGGCTTCCTGGTAC    780
       P--P--T--S--N--Q--S--P--A--S--S--Y--L--E--N--S--A--S--W--Y--
781    CCGAGCGCGGCCAGCTCAATCAATTCCCACGTGCCGCCGCCCGGCTCCTTGCAGCACCCG    840
       P--S--A--A--S--S--I--N--S--H--V--P--P--P--G--S--L--Q--H--P--
841    CTGGCGCTGGCCTCGGGGACGCTCTATTAG                                  900
       L--A--L--A--S--G--T--L--Y--***