Imprinted Gene Databases

Sus scrofa: CD81

CD81 molecule
Species Gene Aliases Location Status Expressed Allele
Homo sapiens CD81 S5.7, TAPA1, TSPAN28  11p15.5  Not Imprinted Biallelic
Bos taurus CD81   29  Not Imprinted Biallelic
Mus musculus Cd81 Tapa1, Tapa-1, Tspan28  7 69.3 cM  Imprinted Maternal
Sus scrofa CD81     Not Imprinted Biallelic
1      ATGGGGGTAGAGGGCTGCACCAAGTGCATCAAGGACCTGCTCTTCGTCTTCAATTTCGTC     60
       M--G--V--E--G--C--T--K--C--I--K--D--L--L--F--V--F--N--F--V--
61     TTCTGGCTGGCTGGAGGCGTGATCCTGGGCGTGGCCCTGTGGCTTCGCCACGACCCCCAG    120
       F--W--L--A--G--G--V--I--L--G--V--A--L--W--L--R--H--D--P--Q--
121    ACTACCAGCCTCCTCTACCTGGAGCTCGGAGACAAGCCCGCACCCAATACCTTCTATGTG    180
       T--T--S--L--L--Y--L--E--L--G--D--K--P--A--P--N--T--F--Y--V--
181    GGCATCTACATCCTCATCGCTGTGGGTGCTGTGATGATGTTTGTGGGGTTCCTGGGCTGC    240
       G--I--Y--I--L--I--A--V--G--A--V--M--M--F--V--G--F--L--G--C--
241    TACGGGGCCATCCAGGAGTCACAGTGCTTGCTGGGGACGTTCTTCACCTGCCTCGTGATC    300
       Y--G--A--I--Q--E--S--Q--C--L--L--G--T--F--F--T--C--L--V--I--
301    CTCTTTGCCTGTGAGGTGGCCGCCGGCATCTGGGGTTTCGTCAACAAGGACCAGATCGCC    360
       L--F--A--C--E--V--A--A--G--I--W--G--F--V--N--K--D--Q--I--A--
361    AAGGACGTGAAGCAGTTCTACGACCAGGCCTTGCAGCAGGCCATAGTGGACGACGACGCC    420
       K--D--V--K--Q--F--Y--D--Q--A--L--Q--Q--A--I--V--D--D--D--A--
421    AACAACGCCAAGGCCGTGGTGAAGACTTTCCACGAGACGCTCAACTGCTGCGGCTCCAAC    480
       N--N--A--K--A--V--V--K--T--F--H--E--T--L--N--C--C--G--S--N--
481    ACGCTGACCACGCTGACCACCTCTGTGCTCAAGAACAGCCTGTGCCCCTCGGGTGGCAAC    540
       T--L--T--T--L--T--T--S--V--L--K--N--S--L--C--P--S--G--G--N--
541    ATCATCAGCAACTTGATGAAGGAGGACTGCCACAGCAAGATTGACGAGCTCTTCTCGGGG    600
       I--I--S--N--L--M--K--E--D--C--H--S--K--I--D--E--L--F--S--G--
601    AAGCTGTACCTCATTGGCATCGCAGCCATTGTGGTCGCTGTGATCATGATCTTCGAGATG    660
       K--L--Y--L--I--G--I--A--A--I--V--V--A--V--I--M--I--F--E--M--
661    ATCCTGAGCATGGTACTGTGCTGTGGCATCCGGAACAGCTCGGTGTACTGA             720
       I--L--S--M--V--L--C--C--G--I--R--N--S--S--V--Y--***