Imprinted Gene Databases

Sus scrofa: CD81

CD81 molecule
Species Gene Aliases Location Status Expressed Allele
Homo sapiens CD81 S5.7, TAPA1, TSPAN28  11p15.5  Not Imprinted Biallelic
Mus musculus Cd81 Tapa1, Tapa-1, Tspan28  7 69.3 cM  Imprinted Maternal
Bos taurus CD81   29  Not Imprinted Biallelic
Sus scrofa CD81     Not Imprinted Biallelic
1      ATGGGGGTAGAGGGCTGCACCAAGTGCATCAAGGACCTGCTCTTCGTCTTCAATTTCGTC     60
       M--G--V--E--G--C--T--K--C--I--K--D--L--L--F--V--F--N--F--V--
61     TTCTGGCTGGCTGGAGGCGTGATCCTGGGCGTGGCCCTGTGGCTTCGCCACGACCCCCAG    120
       F--W--L--A--G--G--V--I--L--G--V--A--L--W--L--R--H--D--P--Q--
121    ACTACCAGCCTCCTCTACCTGGAGCTCGGAGACAAGCCCGCACCCAATACCTTCTATGTG    180
       T--T--S--L--L--Y--L--E--L--G--D--K--P--A--P--N--T--F--Y--V--
181    GGCATCTACATCCTCATCGCTGTGGGTGCTGTGATGATGTTTGTGGGGTTCCTGGGCTGC    240
       G--I--Y--I--L--I--A--V--G--A--V--M--M--F--V--G--F--L--G--C--
241    TACGGGGCCATCCAGGAGTCACAGTGCTTGCTGGGGACGTTCTTCACCTGCCTCGTGATC    300
       Y--G--A--I--Q--E--S--Q--C--L--L--G--T--F--F--T--C--L--V--I--
301    CTCTTTGCCTGTGAGGTGGCCGCCGGCATCTGGGGTTTCGTCAACAAGGACCAGATCGCC    360
       L--F--A--C--E--V--A--A--G--I--W--G--F--V--N--K--D--Q--I--A--
361    AAGGACGTGAAGCAGTTCTACGACCAGGCCTTGCAGCAGGCCATAGTGGACGACGACGCC    420
       K--D--V--K--Q--F--Y--D--Q--A--L--Q--Q--A--I--V--D--D--D--A--
421    AACAACGCCAAGGCCGTGGTGAAGACTTTCCACGAGACGCTCAACTGCTGCGGCTCCAAC    480
       N--N--A--K--A--V--V--K--T--F--H--E--T--L--N--C--C--G--S--N--
481    ACGCTGACCACGCTGACCACCTCTGTGCTCAAGAACAGCCTGTGCCCCTCGGGTGGCAAC    540
       T--L--T--T--L--T--T--S--V--L--K--N--S--L--C--P--S--G--G--N--
541    ATCATCAGCAACTTGATGAAGGAGGACTGCCACAGCAAGATTGACGAGCTCTTCTCGGGG    600
       I--I--S--N--L--M--K--E--D--C--H--S--K--I--D--E--L--F--S--G--
601    AAGCTGTACCTCATTGGCATCGCAGCCATTGTGGTCGCTGTGATCATGATCTTCGAGATG    660
       K--L--Y--L--I--G--I--A--A--I--V--V--A--V--I--M--I--F--E--M--
661    ATCCTGAGCATGGTACTGTGCTGTGGCATCCGGAACAGCTCGGTGTACTGA             720
       I--L--S--M--V--L--C--C--G--I--R--N--S--S--V--Y--***