Imprinted Gene Databases

Ovis aries: DIO3

Deiodinase, iodothyronine, type III

Colosimo et al. Anim. Genet. 40: 2009

Species Gene Aliases Location Status Expressed Allele
Sus scrofa DIO3 5DIII, DIOIII  Imprinted Paternal
Ovis aries DIO3 DIO3, 5DIII, DIOIII    Imprinted Paternal
Mus musculus Dio3 MGC124117, MGC124118  12 F1  Imprinted Paternal
Macropus eugenii DIO3     Not Imprinted Biallelic
Homo sapiens DIO3 D3, 5DIII, TXDI3, DIOIII  14q32  Unknown Unknown
1      ATGCTGCGCTCCCTGCTGCTTCACTCCCTGAGGCTCTGCGCCCAGACGGCCTCGTGCCTC     60
       M--L--R--S--L--L--L--H--S--L--R--L--C--A--Q--T--A--S--C--L--
61     GTGCTCTTCCCGCGCTTCCTGGGCACGGCCTTCATGCTCTGGTTGCTAGACTTCCTGTGC    120
       V--L--F--P--R--F--L--G--T--A--F--M--L--W--L--L--D--F--L--C--
121    ATCCGCAAGCATTTACTGGGCCGTCGACGCCGGGGTCAGCCGGAAATCGAAGTGGAGCTC    180
       I--R--K--H--L--L--G--R--R--R--R--G--Q--P--E--I--E--V--E--L--
181    AACAGCGACGGCGAAGAGGTGCCCCCCGACGACCCTCCTGTCTGCGTGTCCGATGACAAC    240
       N--S--D--G--E--E--V--P--P--D--D--P--P--V--C--V--S--D--D--N--
241    CGCCTGTGCACCTTGGCGTCGCTGAGGGCCGTCTGGCACGGCCAGAAGTTGGATTTCTTC    300
       R--L--C--T--L--A--S--L--R--A--V--W--H--G--Q--K--L--D--F--F--
301    AAGCAGGCGCATGAAGGCGGGCCGGCGCCTAACTCTGAGGTGGTCCTGCCCGACGGCTTC    360
       K--Q--A--H--E--G--G--P--A--P--N--S--E--V--V--L--P--D--G--F--
361    CAGAACCAGCACATCCTCGACTACGCCCGAGGAAACCGCCCGCTGGTGCTCAACTTCGGT    420
       Q--N--Q--H--I--L--D--Y--A--R--G--N--R--P--L--V--L--N--F--G--
421    AGCTGCACCTGACCACCGTTCATGGCGCGCATGAGCGCCTTCCAGCGCCTGGTCACCAAG    480
       S--C--T--U--P--P--F--M--A--R--M--S--A--F--Q--R--L--V--T--K--
481    TATCAGCGCGACGTCGACTTCCTCATCATCTACATCGAGGAAGCGCACCCTTCCGACGGC    540
       Y--Q--R--D--V--D--F--L--I--I--Y--I--E--E--A--H--P--S--D--G--
541    TGGGTCACCACAGACTCTCCCTACAGCATCCCGCAGCACCGAAGCCTGGAGGACCGGGTC    600
       W--V--T--T--D--S--P--Y--S--I--P--Q--H--R--S--L--E--D--R--V--
601    AGCGCCGCGCGCGTACTGCAGCAAGGGGCCCCGGAATGCGCTCTCGTGCTCGACACGATG    660
       S--A--A--R--V--L--Q--Q--G--A--P--E--C--A--L--V--L--D--T--M--
661    ACCAACTCCAGCAGCTCGGCCTACGGCGCCTACTTCGAGCGCCTCTACATCATCCAGAGT    720
       T--N--S--S--S--S--A--Y--G--A--Y--F--E--R--L--Y--I--I--Q--S--
721    GGCACCATTATGTACCAGGGCGGCCGCGGCCCCGACGGCTACCAGGTCTCTGAGCTGCGC    780
       G--T--I--M--Y--Q--G--G--R--G--P--D--G--Y--Q--V--S--E--L--R--
781    ACTTGGTTGGAACGCTATGATGAGCAGCTGCACGGCCCGCAGCCCCGTCGAGTGTAA       840
       T--W--L--E--R--Y--D--E--Q--L--H--G--P--Q--P--R--R--V--***