Imprinted Gene Databases

Ovis aries: CDKN1C

Cyclin-dependent kinase inhibitor 1C
Species Gene Aliases Location Status Expressed Allele
Homo sapiens CDKN1C BWS, WBS, p57, BWCR, KIP2  11p15.5  Imprinted Maternal
Macropus eugenii CDKN1C     Not Imprinted Biallelic
Ovis aries CDKN1C CDKN1C    Imprinted
Mus musculus Cdkn1c CDKI, Kip2, p57Kip2, AL024410, p57(kip2)  7 69.49 cM  Imprinted Maternal
1      gccagaggacgagacaATGCGGCCAGCGGCCGGACGACACCGCGAGCGAGCCTCAGGAGC     60
       ................M--R--P--A--A--G--R--H--R--E--R--A--S--G--A-
61     AGTCAGCGGCCCGACAGCCAGAGCATTGGCAATGGAGCGCCTGGTCGCCCGCCGCACCTT    120
       -V--S--G--P--T--A--R--A--L--A--M--E--R--L--V--A--R--R--T--F-
121    TCCCATGATCGCGCGCACCAGCGCCTGCCGCAGCCTCTTCGGGCCCGTGGACCACGAGGA    180
       -P--M--I--A--R--T--S--A--C--R--S--L--F--G--P--V--D--H--E--E-
181    GCTGGGCCGTGAGCTGCAGATGCGCCTGGCCGAGCTGAGCGCCGAGGACCAGCGTCGCTG    240
       -L--G--R--E--L--Q--M--R--L--A--E--L--S--A--E--D--Q--R--R--W-
241    GGACTACAACTTCCAGCTGGACATGCCACTGCGGGGCCCCGGGCGCCTGCAGTGGACCGA    300
       -D--Y--N--F--Q--L--D--M--P--L--R--G--P--G--R--L--Q--W--T--E-
301    GGTGGACAGCGACTCCGTGCCCGCCTTCTATCGCGAGACGGTGCAGGTGGGGCGCTGTCG    360
       -V--D--S--D--S--V--P--A--F--Y--R--E--T--V--Q--V--G--R--C--R-
361    CCTGCTCCTGGCGCCTCGTCCCCGCCCGGACGGCGCGGTCAATAGCCCGCCTCCCGGGCC    420
       -L--L--L--A--P--R--P--R--P--D--G--A--V--N--S--P--P--P--G--P-
421    GCCGGCCGATGAGTCCCTCGACGGCCTCGAGGAGGCGCCGGCGTCGCCGTCCAGCGGCCC    480
       -P--A--D--E--S--L--D--G--L--E--E--A--P--A--S--P--S--S--G--P-
481    GGCCGTAGCGCCTGCCCAGGCCGCGGCCCCGGCGCCTCAGGAGGGCGCTGAGCAGGAGGC    540
       -A--V--A--P--A--Q--A--A--A--P--A--P--Q--E--G--A--E--Q--E--A-
541    GGTCCCGCCGCCGCGCGGCCAGGAGCCCCAGGCCGAGCCGCCGCACTCAGGGATTTCGGG    600
       -V--P--P--P--R--G--Q--E--P--Q--A--E--P--P--H--S--G--I--S--G-
601    GCGCCCCGCGCCGGGCACTGCCGCCGCTGCCACCAACACCGCCGCCAGCGGCGCCGCTGT    660
       -R--P--A--P--G--T--A--A--A--A--T--N--T--A--A--S--G--A--A--V-
661    TGCCACCACTGCCGCCGCCGGAGGCGCCGCGATCAAGAAGCTGTCCGGGCCTCTCATCTC    720
       -A--T--T--A--A--A--G--G--A--A--I--K--K--L--S--G--P--L--I--S-
721    CGACTTCTTCGCCAAGCGCAAGAGACCCGCGCCCGAAACCAAGGCGTCGAACGATGTTCC    780
       -D--F--F--A--K--R--K--R--P--A--P--E--T--K--A--S--N--D--V--P-
781    CGCGGGATGCGCCGCGCCTGGCGCCGCTCCAGCCGTCGGCTCGGCTGAGCAAACCCCGCG    840
       -A--G--C--A--A--P--G--A--A--P--A--V--G--S--A--E--Q--T--P--R-
841    CAAGCGGCTGCGATGAgagcctcgtgcccaaagagccctgacggagcccgttgggcagcg    900
       -K--R--L--R--***............................................
901    gacaggagaggagcgctgggcctcggctgggaccgtccatgtagcagcaaccggcggcag    960
       ............................................................
961    ctgccgcgagcagcgttcggtttcgtgtttaaagtttgacaactgtgcaatgtattaata   1020
       ............................................................
1021   acgtcttttatatctaaatgtattctgcccaaggagtacactggtcccaggtgtaaagct   1080
       ............................................................
1081   tttagagtcatttatataaaatgttaatctctgctgaactcagtgcaaaaaaaatgaaaa   1140
       ............................................................
1141   agccaaaaaaaaggaaaaaagaaaaaaaaccctgtatatttgtacaaaaagtttttaaag   1200
       ............................................................
1201   ttatactaacttatattttctatttatgtggaggcgtgggccgctctgccacgccgcagc   1260
       ............................................................
1261   tcggttattggttatgccaaaggcacctcactcgcatctggttatcagcaaatgtaaatc   1320
       ............................................................
1321   tattttttgtagcgtattctgggggaggggtcactcacaagctatagctgccgtacaagc   1380
       ............................................................
1381   ccatctagcttgcagtctcttcgcgctttcgctgtctcttcttactattatgattatttt   1440
       ............................................................
1441   aaactggaagacaaatctgtttttttaaaaaatggttcctgagccgtctgcaccactgcc   1500
       ............................................................
1501   ccggctcctcgtccgccgggttctaaataaagaggccgaaaaaatgctgcaaaaaaaaaa   1560
       ............................................................
1561   aaaaaaaaaaaaa                                                  1620
       .............