Imprinted Gene Databases

Ovis aries: CDKN1C

Cyclin-dependent kinase inhibitor 1C
Species Gene Aliases Location Status Expressed Allele
Homo sapiens CDKN1C BWS, WBS, p57, BWCR, KIP2  11p15.5  Imprinted Maternal
Mus musculus Cdkn1c CDKI, Kip2, p57Kip2, AL024410, p57(kip2)  7 69.49 cM  Imprinted Maternal
Ovis aries CDKN1C CDKN1C    Imprinted
Macropus eugenii CDKN1C     Not Imprinted Biallelic
841    CAAGCGGCTGCGATGAgagcctcgtgcccaaagagccctgacggagcccgttgggcagcg    900
901    gacaggagaggagcgctgggcctcggctgggaccgtccatgtagcagcaaccggcggcag    960
961    ctgccgcgagcagcgttcggtttcgtgtttaaagtttgacaactgtgcaatgtattaata   1020
1021   acgtcttttatatctaaatgtattctgcccaaggagtacactggtcccaggtgtaaagct   1080
1081   tttagagtcatttatataaaatgttaatctctgctgaactcagtgcaaaaaaaatgaaaa   1140
1141   agccaaaaaaaaggaaaaaagaaaaaaaaccctgtatatttgtacaaaaagtttttaaag   1200
1201   ttatactaacttatattttctatttatgtggaggcgtgggccgctctgccacgccgcagc   1260
1261   tcggttattggttatgccaaaggcacctcactcgcatctggttatcagcaaatgtaaatc   1320
1321   tattttttgtagcgtattctgggggaggggtcactcacaagctatagctgccgtacaagc   1380
1381   ccatctagcttgcagtctcttcgcgctttcgctgtctcttcttactattatgattatttt   1440
1441   aaactggaagacaaatctgtttttttaaaaaatggttcctgagccgtctgcaccactgcc   1500
1501   ccggctcctcgtccgccgggttctaaataaagaggccgaaaaaatgctgcaaaaaaaaaa   1560
1561   aaaaaaaaaaaaa                                                  1620