Imprinted Gene Databases

Ovis aries: BEGAIN

Brain-enriched guanylate kinase-associated homolog

Smit et al. Mamm. Genome 18: 801-814, 2005

Species Gene Aliases Location Status Expressed Allele
Mus musculus Begain Gm897, BM948371  12 F1  Imprinted Isoform Dependent
Ovis aries BEGAIN BEGAIN, BEGAIN2B    Imprinted Isoform Dependent
1      cccggggccATGTGGACGGGCGGCCGGCGGCCGGGCCGGCTCCGCCGGGCGGCCTCTGCC     60
       .........M--W--T--G--G--R--R--P--G--R--L--R--R--A--A--S--A--
61     GCAGACATGGAGAAACTCAGGCTGCGCAGCGCCTGGGTGCCCTCGTGCCTCGGGCAGTCC    120
       A--D--M--E--K--L--R--L--R--S--A--W--V--P--S--C--L--G--Q--S--
121    CGCAACCTGCAGGGCCGACGGGCCAGGTCCTCGCCCTCGCTTTGGGACAGCTCGCTCCAG    180
       R--N--L--Q--G--R--R--A--R--S--S--P--S--L--W--D--S--S--L--Q--
181    GAGCAGAAGGGCGAGCTGCGCAAGCGGCTATCCTACACGACGCACCGGCTGGAGAAGCTG    240
       E--Q--K--G--E--L--R--K--R--L--S--Y--T--T--H--R--L--E--K--L--
241    GAGAACGAGTTCGACTCCACCCGCCACTTCTTGGAGATCGAACTGCGCCGTGCGCAGGAG    300
       E--N--E--F--D--S--T--R--H--F--L--E--I--E--L--R--R--A--Q--E--
301    GAGCTGGAGAAAGTTACCGAGAAGCTGCGCAGGATTCAGAGCAACTACATGGCCCTGCAG    360
       E--L--E--K--V--T--E--K--L--R--R--I--Q--S--N--Y--M--A--L--Q--
361    AGGATCAACCAGGAGCTGGAGGACAAGCTATTCCGCATGGGCCAGCACTATGAGGAAGAG    420
       R--I--N--Q--E--L--E--D--K--L--F--R--M--G--Q--H--Y--E--E--E--
421    AAACGAGCTCTCAGCCATGAGATTGTCGCCCTCAACAGCCACCTGCTGGAGGCCAAAGTG    480
       K--R--A--L--S--H--E--I--V--A--L--N--S--H--L--L--E--A--K--V--
481    ACGATTGACAAGCTCTCGGAGGACAATGAGCTCTACAGGAAGGACTGCAGCCTCGCAGCG    540
       T--I--D--K--L--S--E--D--N--E--L--Y--R--K--D--C--S--L--A--A--
541    CAGCTGCTGCAGTGCAGCCAGGCCTACGGCAGGGGCCGCAAGATGGCCGAGCTGCCCGCG    600
       Q--L--L--Q--C--S--Q--A--Y--G--R--G--R--K--M--A--E--L--P--A--
601    GAGTTCCAGGAACGCATGAACCTGCACGCGGAGAAGCCAGGCTGCAGCCTGCCCGCCCCG    660
       E--F--Q--E--R--M--N--L--H--A--E--K--P--G--C--S--L--P--A--P--
661    CCCCGCCGCCCGGCCTACGCAGACAGCGTGCCCCCCTGCGTGCTCGCCAAGGTGCTGGAG    720
       P--R--R--P--A--Y--A--D--S--V--P--P--C--V--L--A--K--V--L--E--
721    AAGCCGGACCCCGGCAGCCTGTCCTCCCACCTGTCGGAAGCCTCGGCCCAAGACCTGGGC    780
       K--P--D--P--G--S--L--S--S--H--L--S--E--A--S--A--Q--D--L--G--
781    TTCCCCGAGGGGCTGGAGAAGCCAGGGTCCCGACCCCCCTACAAGGGGGACATCTACTGC    840
       F--P--E--G--L--E--K--P--G--S--R--P--P--Y--K--G--D--I--Y--C--
841    AGCGACACGGCCCTCTACTGCCCTGAGGCGCGGCACCAAGACCGGCGGCCCAGCGTGGAG    900
       S--D--T--A--L--Y--C--P--E--A--R--H--Q--D--R--R--P--S--V--E--
901    GGGCCCGGGTCCGATGTGGGCTTCCTGCAGGCCCAGAACTCCACCGACAGCACGGCGGAG    960
       G--P--G--S--D--V--G--F--L--Q--A--Q--N--S--T--D--S--T--A--E--
961    GAGGAGGAGGAGGAGGAGGAGGATACCGAGGCCGGCGCGGCGGCCTACCCCGCCAGCTAC   1020
       E--E--E--E--E--E--E--D--T--E--A--G--A--A--A--Y--P--A--S--Y--
1021   CGCCATGAGGCCTTCGGCGGCTACGCAGCCTCGCTGCCCACGTCCAGCTCCTACTCCAGC   1080
       R--H--E--A--F--G--G--Y--A--A--S--L--P--T--S--S--S--Y--S--S--
1081   TTCAGCGCCGCGTCCGAAGAGAAGGAGCATGCCCAGGCCAGCACGCTGACCGCCTCGCAG   1140
       F--S--A--A--S--E--E--K--E--H--A--Q--A--S--T--L--T--A--S--Q--
1141   CAGGCCATCTACCTGAACAGCCGCGATGAGCTCTTCGGCCGCAAGCCCGCTGCGGCCTAC   1200
       Q--A--I--Y--L--N--S--R--D--E--L--F--G--R--K--P--A--A--A--Y--
1201   GGGAGCAGCCCACGCTATGCGGCTGCCGCGGCTGCGGTGGCTGCCCCGCTGGAGGCCGCA   1260
       G--S--S--P--R--Y--A--A--A--A--A--A--V--A--A--P--L--E--A--A--
1261   ATGGCTCCGGGGTTCCCCAGGACTGTGTCACCGTTCCCCGGCGAGCCCTTCCGCTTCCCG   1320
       M--A--P--G--F--P--R--T--V--S--P--F--P--G--E--P--F--R--F--P--
1321   CTCTCCCCAGGCCCCCAGCCTGCCCTGATGCCCCCCAACCTGTGGAACCTGCGGGCCAAG   1380
       L--S--P--G--P--Q--P--A--L--M--P--P--N--L--W--N--L--R--A--K--
1381   CCTGGGTCCGCCCGGCTGGTCGCAGGGGCCGGCCGCGGCCAGTGGCGGCCGCTGAGCGTG   1440
       P--G--S--A--R--L--V--A--G--A--G--R--G--Q--W--R--P--L--S--V--
1441   GATGACATCGGCGCCTACCCCTTTCCGGCCGCGGCCGCGGCCCCTGCCCCCAGCCTCGCC   1500
       D--D--I--G--A--Y--P--F--P--A--A--A--A--A--P--A--P--S--L--A--
1501   TCACCCGGCGGCGGCTTCAATGACCGCTACTTTGGGGCCCGAGGCGGCCCCGGCGACAAC   1560
       S--P--G--G--G--F--N--D--R--Y--F--G--A--R--G--G--P--G--D--N--
1561   GCCGAGGGCCGCGCCAGCCCCCTCTACGCCAGCTACAAGGCTGATAGCTTCTCGGAGGGC   1620
       A--E--G--R--A--S--P--L--Y--A--S--Y--K--A--D--S--F--S--E--G--
1621   GATGACCTCTCCCAGGGCCACCTGGTCGAGCCCCGCTACCTCCGGGCAGCTGGTGACCTG   1680
       D--D--L--S--Q--G--H--L--V--E--P--R--Y--L--R--A--A--G--D--L--
1681   AGCCTTAGCCCCGGCCACTCGGCCGACCCCCTGCCCAGCTATGCGGCCAGTGAGGGGGAC   1740
       S--L--S--P--G--H--S--A--D--P--L--P--S--Y--A--A--S--E--G--D--
1741   CGCGAGCGGCTCGGGGTGCAGCTCCTCGGGGCAAGCGGTAGCCCCGAGCCTGAGCTCAGC   1800
       R--E--R--L--G--V--Q--L--L--G--A--S--G--S--P--E--P--E--L--S--
1801   CTCCGCAGCTCCAGGGACTCCCTGGAGCCCAGCTCCATGGAGGCCTCCCCGGAGATGCAC   1860
       L--R--S--S--R--D--S--L--E--P--S--S--M--E--A--S--P--E--M--H--
1861   CCCGGTGCCCGCCTCAGTCCCCAGCCTGCCTTCCCTCGGGCGGGCAGCTCGGGGCTCAGC   1920
       P--G--A--R--L--S--P--Q--P--A--F--P--R--A--G--S--S--G--L--S--
1921   CGCAAGGACAGCCTCACGAAAGCCCAGCTCTACGGAACCCTGCTCAACTGAgcaccccac   1980
       R--K--D--S--L--T--K--A--Q--L--Y--G--T--L--L--N--***.........
1981   gtgcgggccctgccacggccagtcccgcacaccgggttcccaggggtgctgcctcgactc   2040
       ............................................................
2041   cccgacaaccccaccctctcggccctgcacaccaggacccctctccacctaacccactcg   2100
       ............................................................
2101   agcccgagagggggaccccaaccagagcgtcttgtccaccccgcaccaccactgtgcaac   2160
       ............................................................
2161   gttttctgactcagcagcagccttccccgactgaaatgagtatccttcccccttgccacc   2220
       ............................................................
2221   ccctccgcccccagctttaccaagtgcgactattcttatagagcaaagtgtcttaacaca   2280
       ............................................................
2281   ctcggcctccagctccctggacggcagccccgggcgttttcagtgcaaacgctgctggat   2340
       ............................................................
2341   gtttttgggcaaaggcaggtggggcctgcccctgggaagggaagggaagggtggagatat   2400
       ............................................................
2401   ccccagtgatgaggggaccggaagctgtgtccacaggaagggggactggaacgggtgatg   2460
       ............................................................
2461   ggatgtgaaacgcttctagctgttctttccgtgtggccgacgacccctcccccagctcta   2520
       ............................................................
2521   ctgtggtccgtagtcccgtgtgt                                        2580
       .......................