Imprinted Gene Databases

Mus musculus: Magi2

Membrane associated guanylate kinase, WW and PDZ domain containing 2

Luedi et al. Genome Res 17: 1723-1730, 2007 PDF; Luedi et al. Genome Res 17: 1723-1730, 2007 Supplement; Barbaux et al. Epigenetics 7:1079; Genomic sequence is not displayed because it is too large.

Species Gene Aliases Location Status Expressed Allele
Homo sapiens MAGI2 AIP1, AIP-1, ARIP1, SSCAM, MAGI-2, ACVRIP1  7q21  Imprinted Maternal
Mus musculus Magi2 AIP-1, Acvri1, Magi-2, S-SCAM, Acvrip1, Acvrinp1, mKIAA0705  Imprinted Paternal
1      caaaagtgagagacaggcagacttgcgtagagcccaggttctcatgcagtgagatgtaaa     60
       ............................................................
61     tgaccctgactgaatgggaatccagtgaggtggctagtggggggtgggggaagagacagg    120
       ............................................................
121    agggagagagcaaacgccagagagagagagagagagagagagagagagagagagagagag    180
       ............................................................
181    agagagagagagagagagagagagagcaagcgctagagagagagagagagcgagctgcat    240
       ............................................................
241    gcttcatctttgaggggagggaaaacaaaagacctcaggagcagttttgtgttgctgtgt    300
       ............................................................
301    ctggcttcaagaagaaaattctagacatttatgccggcaagaccaaagctcagctaagac    360
       ............................................................
361    tacttctcccaagaagataattgtatcagaggatgggttggatcagtacaggtggtttga    420
       ............................................................
421    ggagacgctgacagaggaccatggaaaggtgggagaggacgcgcggctcctgggcttcct    480
       ............................................................
481    ctgagctcagctccaggcaccacaaggccacataaggagggtgaggtccctggagtggac    540
       ............................................................
541    tacattttcataaccgttgaggagtttATGGAATTGGAGAAAAGTGGTGCTCTCCTAGAA    600
       ...........................M--E--L--E--K--S--G--A--L--L--E--
601    AGCGGGACCTATGAAGACAACTACTACGGTACCCCGAAGCCTCCAGCTGAACCAGCACCA    660
       S--G--T--Y--E--D--N--Y--Y--G--T--P--K--P--P--A--E--P--A--P--
661    TTATTAAATGTAACAGACCAGATACTTCCGGGAGCTACTCCAAGTGCTGAGGGGAAGCGG    720
       L--L--N--V--T--D--Q--I--L--P--G--A--T--P--S--A--E--G--K--R--
721    AAAAGAAATAAGTCAGTGACCAACATGGAGAAAGCAAGTATAGAGCCTCCAGAGGAGGAA    780
       K--R--N--K--S--V--T--N--M--E--K--A--S--I--E--P--P--E--E--E--
781    GAAGAAGAAAGGCCTGTAGTCAATGGAAACGGCGTGGTCATAACCCCAGAATCCAGTGAA    840
       E--E--E--R--P--V--V--N--G--N--G--V--V--I--T--P--E--S--S--E--
841    CATGAAGACAAAAGTGCAGGTGCCTCAGGGGAGACACCCTCCCAGCCTTACCCTGCACCC    900
       H--E--D--K--S--A--G--A--S--G--E--T--P--S--Q--P--Y--P--A--P--
901    GTGTACAGCCAGCCCGAAGAGCTCAAGGACCAGATGGACGATACAAAGCCAACAAAGCCT    960
       V--Y--S--Q--P--E--E--L--K--D--Q--M--D--D--T--K--P--T--K--P--
961    GAGGAGAACGAGGACTCTGATCCATTGCCTGATAACTGGGAAATGGCCTACACAGAGAAG   1020
       E--E--N--E--D--S--D--P--L--P--D--N--W--E--M--A--Y--T--E--K--
1021   GGGGAAGTCTACTTCATTGACCATAACACAAAGACAACATCATGGCTGGATCCGCGACTT   1080
       G--E--V--Y--F--I--D--H--N--T--K--T--T--S--W--L--D--P--R--L--
1081   GCGAAAAAGGCTAAACCTCCAGAAGAGTGCAAAGAAAATGAGCTTCCATATGGCTGGGAA   1140
       A--K--K--A--K--P--P--E--E--C--K--E--N--E--L--P--Y--G--W--E--
1141   AAAATCGATGATCCTATATATGGCACTTACTATGTTGACCACATAAATAGAAGAACACAG   1200
       K--I--D--D--P--I--Y--G--T--Y--Y--V--D--H--I--N--R--R--T--Q--
1201   TTTGAAAACCCTGTCCTGGAAGCAAAAAGGAAGCTACAGCAACATAACATGCCCCACACA   1260
       F--E--N--P--V--L--E--A--K--R--K--L--Q--Q--H--N--M--P--H--T--
1261   GAACTTGGAGCAAAGCCCCTGCAGGCCCCAGGTTTCCGAGAAAAGCCACTCTTCACCCGG   1320
       E--L--G--A--K--P--L--Q--A--P--G--F--R--E--K--P--L--F--T--R--
1321   GATGCATCCCAGTTGAAGGGAACGTTCCTCAGCACCACCCTCAAAAAGAGCAACATGGGC   1380
       D--A--S--Q--L--K--G--T--F--L--S--T--T--L--K--K--S--N--M--G--
1381   TTTGGGTTTACCATCATTGGTGGAGACGAGCCGGATGAGTTTCTACAGGTGAAAAGTGTG   1440
       F--G--F--T--I--I--G--G--D--E--P--D--E--F--L--Q--V--K--S--V--
1441   ATCCCGGATGGGCCTGCCGCACAGGATGGGAAAATGGAGACAGGTGATGTCATTGTCTAT   1500
       I--P--D--G--P--A--A--Q--D--G--K--M--E--T--G--D--V--I--V--Y--
1501   ATTAATGAAGTTTGTGTCCTTGGACACACTCATGCAGATGTTGTCAAACTTTTCCAGTCT   1560
       I--N--E--V--C--V--L--G--H--T--H--A--D--V--V--K--L--F--Q--S--
1561   GTTCCTATTGGTCAGAGTGTCAACTTGGTGTTGTGTCGTGGCTACCCTTTGCCCTTTGAC   1620
       V--P--I--G--Q--S--V--N--L--V--L--C--R--G--Y--P--L--P--F--D--
1621   CCTGAAGATCCTGCTAACAGCATGGTGCCACCCCTTGCAATAATGGAGAGGCCACCTCCG   1680
       P--E--D--P--A--N--S--M--V--P--P--L--A--I--M--E--R--P--P--P--
1681   GTGATGGTCAATGGAAGACATAACTATGAAACATACTTGGAATACATTTCTCGGACCTCA   1740
       V--M--V--N--G--R--H--N--Y--E--T--Y--L--E--Y--I--S--R--T--S--
1741   CAGTCGGTCCCAGATATTACAGACCGGCCACCTCATTCTTTGCACTCCATGCCAGCTGAC   1800
       Q--S--V--P--D--I--T--D--R--P--P--H--S--L--H--S--M--P--A--D--
1801   GGCCAGCTAGATGGCACGTATCCACCACCCGTCCATGACGACAATGTGTCTATGGCTTCG   1860
       G--Q--L--D--G--T--Y--P--P--P--V--H--D--D--N--V--S--M--A--S--
1861   TCTGGAGCCACTCAAGCTGAACTTATGACCTTAACCATTGTGAAAGGTGCCCAGGGATTT   1920
       S--G--A--T--Q--A--E--L--M--T--L--T--I--V--K--G--A--Q--G--F--
1921   GGCTTTACTATTGCCGACAGTCCCACGGGACAGCGGGTGAAACAAATCCTTGACATTCAG   1980
       G--F--T--I--A--D--S--P--T--G--Q--R--V--K--Q--I--L--D--I--Q--
1981   GGATGCCCTGGGCTGTGTGAAGGAGACCTCATTGTTGAGATCAACCAACAGAATGTACAG   2040
       G--C--P--G--L--C--E--G--D--L--I--V--E--I--N--Q--Q--N--V--Q--
2041   AACCTGAGCCATACAGAAGTAGTGGATATACTTAAGGACTGCCCCGTTGGAAGTGAGACT   2100
       N--L--S--H--T--E--V--V--D--I--L--K--D--C--P--V--G--S--E--T--
2101   TCTTTAATCATCCATCGAGGAGGTTTCTTTTCTCCATGGAAAACTCCAAAGCCTATGATG   2160
       S--L--I--I--H--R--G--G--F--F--S--P--W--K--T--P--K--P--M--M--
2161   GACCGATGGGAGAACCAAGGCAGTCCACAAACAAGTTTATCTGCTCCGGCCGTCCCACAG   2220
       D--R--W--E--N--Q--G--S--P--Q--T--S--L--S--A--P--A--V--P--Q--
2221   AACCTGCCCTTCCCACCTGCCCTTCACAGGAGCTCCTTTCCTGATTCAACAGAGGCCTTT   2280
       N--L--P--F--P--P--A--L--H--R--S--S--F--P--D--S--T--E--A--F--
2281   GACCCACGGAAGCCTGACCCATATGAGCTCTACGAGAAATCGAGAGCCATTTATGAAAGT   2340
       D--P--R--K--P--D--P--Y--E--L--Y--E--K--S--R--A--I--Y--E--S--
2341   AGGCAACAAGTGCCACCCAGGACCAGTTTTCGAATGGATTCCTCTGGTCCAGATTATAAG   2400
       R--Q--Q--V--P--P--R--T--S--F--R--M--D--S--S--G--P--D--Y--K--
2401   GAACTGGATGTTCACCTTCGGAGGATGGAGTCTGGATTTGGCTTTAGAATCCTTGGGGGA   2460
       E--L--D--V--H--L--R--R--M--E--S--G--F--G--F--R--I--L--G--G--
2461   GATGAACCTGGACAGCCTATTTTGATCGGAGCCGTCATTGCCATGGGCTCAGCTGACAGA   2520
       D--E--P--G--Q--P--I--L--I--G--A--V--I--A--M--G--S--A--D--R--
2521   GACGGCCGTCTACACCCAGGAGATGAGCTTGTCTATGTCGATGGGATCCCAGTGGCTGGC   2580
       D--G--R--L--H--P--G--D--E--L--V--Y--V--D--G--I--P--V--A--G--
2581   AAGACCCACCGCTATGTCATCGACCTCATGCACCACGCGGCCCGCAATGGGCAGGTTAAC   2640
       K--T--H--R--Y--V--I--D--L--M--H--H--A--A--R--N--G--Q--V--N--
2641   CTCACTGTGAGAAGAAAGGTGCTATGTGGAGGGGAGCCCTGCCCAGAGAATGGGAGGAGT   2700
       L--T--V--R--R--K--V--L--C--G--G--E--P--C--P--E--N--G--R--S--
2701   CCAGGCTCTGTATCAACTCACCACAGCTCTCCGCGCAGTGACTATGCCACCTACTCCAAC   2760
       P--G--S--V--S--T--H--H--S--S--P--R--S--D--Y--A--T--Y--S--N--
2761   AGCAACCACGCCGCCCCCAGCAGCAATGCCTCACCTCCTGAAGGCTTTGCCTCACACAGC   2820
       S--N--H--A--A--P--S--S--N--A--S--P--P--E--G--F--A--S--H--S--
2821   TTGCAGACCAGTGATGTGGTCATTCACCGCAAAGAAAACGAAGGGTTTGGCTTCGTCATC   2880
       L--Q--T--S--D--V--V--I--H--R--K--E--N--E--G--F--G--F--V--I--
2881   ATCAGCTCTCTGAACAGGCCTGAGTCTGGAGCCACCATAACTGTGCCCCATAAAATTGGA   2940
       I--S--S--L--N--R--P--E--S--G--A--T--I--T--V--P--H--K--I--G--
2941   CGAATCATTGATGGGAGCCCTGCAGATCGCTGTGCCAAACTCAAAGTGGGCGACCGTATC   3000
       R--I--I--D--G--S--P--A--D--R--C--A--K--L--K--V--G--D--R--I--
3001   TTAGCAGTCAACGGCCAGTCTATCATCAACATGCCTCACGCTGACATTGTGAAGCTCATC   3060
       L--A--V--N--G--Q--S--I--I--N--M--P--H--A--D--I--V--K--L--I--
3061   AAGGACGCCGGTCTCAGTGTCACCCTTCGCATCATTCCTCAGGAGGAGCTCAACAGCCCA   3120
       K--D--A--G--L--S--V--T--L--R--I--I--P--Q--E--E--L--N--S--P--
3121   ACATCAGCACCCAGTTCAGAGAAACAGAGCCCCATGGCCCAGCAGCACAGCCCTCTGGCC   3180
       T--S--A--P--S--S--E--K--Q--S--P--M--A--Q--Q--H--S--P--L--A--
3181   CAGCAGAGTCCTCTGGCCCAGCCAAGCCCCGCCACCCCCAACAGCCCAGTCGCACAGCCA   3240
       Q--Q--S--P--L--A--Q--P--S--P--A--T--P--N--S--P--V--A--Q--P--
3241   GCTCCTCCCCAACCTCTCCAGCTGCAAGGACACGAAAATAGTTACAGGTCAGAAGTTAAA   3300
       A--P--P--Q--P--L--Q--L--Q--G--H--E--N--S--Y--R--S--E--V--K--
3301   GCGAGGCAAGATGTGAAGCCAGACATCCGGCAGCCTCCCTTCACAGACTACAGGCAGCCC   3360
       A--R--Q--D--V--K--P--D--I--R--Q--P--P--F--T--D--Y--R--Q--P--
3361   CCGCTGGACTACAGGCAGCCCCCGGGAGGAGACTACTCACAGCCCCCACCCTTGGACTAC   3420
       P--L--D--Y--R--Q--P--P--G--G--D--Y--S--Q--P--P--P--L--D--Y--
3421   AGGCAGCACTCTCCAGACACCAGGCAGTACCCTCTGTCAGACTACAGGCAGCCACAGGAT   3480
       R--Q--H--S--P--D--T--R--Q--Y--P--L--S--D--Y--R--Q--P--Q--D--
3481   TTTGATTATTTCACTGTGGACATGGAGAAAGGAGCCAAAGGATTTGGATTCAGCATTCGT   3540
       F--D--Y--F--T--V--D--M--E--K--G--A--K--G--F--G--F--S--I--R--
3541   GGAGGAAGGGAATACAAGATGGATCTGTATGTGTTGAGATTGGCAGAGGATGGGCCAGCC   3600
       G--G--R--E--Y--K--M--D--L--Y--V--L--R--L--A--E--D--G--P--A--
3601   ATAAGGAACGGCAGGATGAGGGTAGGAGATCAGATCATTGAAATAAATGGGGAAAGCACA   3660
       I--R--N--G--R--M--R--V--G--D--Q--I--I--E--I--N--G--E--S--T--
3661   CGAGACATGACCCACGCCAGAGCAATAGAACTCATCAAGTCTGGAGGAAGAAGAGTGCGG   3720
       R--D--M--T--H--A--R--A--I--E--L--I--K--S--G--G--R--R--V--R--
3721   CTGCTGCTGAAGAGAGGCACGGGGCAGGTCCCGGAGTATGGAATGGTACCTTCCAGCCTC   3780
       L--L--L--K--R--G--T--G--Q--V--P--E--Y--G--M--V--P--S--S--L--
3781   TCCATGTGCATGAAAAGTGACAAGCATGGGTCCCCATATTTCTACTTACTGGGCCACCCT   3840
       S--M--C--M--K--S--D--K--H--G--S--P--Y--F--Y--L--L--G--H--P--
3841   AAAGACACGACGAACCCCACGCCTGGAGTGCTGCCGCTGCCGCCGCCCCAGGCCTGCCGG   3900
       K--D--T--T--N--P--T--P--G--V--L--P--L--P--P--P--Q--A--C--R--
3901   AAGTAGgcgtctccctcgaagacatcctctctccattctctccatcacatccagccccac   3960
       K--***......................................................
3961   cctccgacccttcccaccagataggcccagacccaacttgggatatccaaagggaacacg   4020
       ............................................................
4021   acgttaggaaaccaaaggagctttcggccggcggccagaagaagcagcgcctgggggagc   4080
       ............................................................
4081   agagggagcgctcggcgagcccgcagcgcagtgcgcggcccaggctggaggaggtgcccg   4140
       ............................................................
4141   gcggccaggggcggcccgaggccggcaggcccgcctcggaggcggccgacgggaaggagg   4200
       ............................................................
4201   cgctgcgcggccggcgtgagggcctcggggccgcgggcgcgcgggaggccgaggccaagg   4260
       ............................................................
4261   tgggtgtgcgctcgggggcccgacccgcagcgcggcccacggggggcggcccagcgcgca   4320
       ............................................................
4321   aggcgacgatggcgccggggccctggaaggtgccgggctccgacaagctgccgggcgccc   4380
       ............................................................
4381   tgcagcctggcgcctcggccgcgggcagatgagccccaaggcgaggggcccccgcccgcc   4440
       ............................................................
4441   tccacgcaggccgatcttcctgggttccgtctcacggcgttttaatttatttccactgtc   4500
       ............................................................
4501   acacgcatagatctatacgaggcgccgaagcccgggagcgccggcgtgcgacgcgcgtag   4560
       ............................................................
4561   gcggcacggcacggtgtgcgcgcaggcagacctaaactgatcctaaagcccccggttcca   4620
       ............................................................
4621   tggtgggagctttggcagctacggaagaaccaaaatcacgcaaacatcacagagagacag   4680
       ............................................................
4681   tgcagtgtagctttagattcaaaaagagaaaaagaaaaaagttccccccactgcatgaag   4740
       ............................................................
4741   gatttggatgtcatccaaactttatatcaagaaactggacaagttcagagcaatcacaaa   4800
       ............................................................
4801   ctggaatatcgccttaaaaaaaaatcaaactgcacggagcaagcggaaactgagacaaga   4860
       ............................................................
4861   ttatatcttttaattgatctaaagtgttgtaaataaatcgttcttgacatatctagacag   4920
       ............................................................
4921   gggataaagggtttctttgaaacatccagaactgttctcccatgctacgtttccatggct   4980
       ............................................................
4981   cccccttcagcatccaccaacggtattagcagcagcgtcccctgcctactgcaggatgag   5040
       ............................................................
5041   ttagaaacctagtgaattcattggtgtgatgccttttttactgccatttctgtggtcaag   5100
       ............................................................
5101   tcacatttctgtacattttcagtagtagggaaaaaaggttttaaaaattgtatcctaggg   5160
       ............................................................
5161   agcagtttgccgtaagtcagaattttgcaggttagctcgtagatcctaattggttgcctc   5220
       ............................................................
5221   taaaataatgagtttgataatcaaaagaccataatctgtttaatcgagattgacaacgct   5280
       ............................................................
5281   gcagttccttcctgaaaaggcttcctgtcatcccaggcactcagagatacgtagctgctc   5340
       ............................................................
5341   tgttagcaatcttctattttacctatttgattgtcttattttaaagctcttcatttgcac   5400
       ............................................................
5401   tttgacaaagtatttgtcctatatttctcaaattagaatctctaatattgaaagcattat   5460
       ............................................................
5461   gataactaatttattttcattaaagaacataagtcctttggcattcctttctgctttcct   5520
       ............................................................
5521   tatttgatctcctttttgtttccacctgtagcttttcgcctccaatttgctaatgctttt   5580
       ............................................................
5581   tgttacactaacaatctatagatgcacctttatgtccccgggttaccatcgcaggtcagc   5640
       ............................................................
5641   gattgtccctgcagtaaaaactgtcaaacgttaacattagtcagctatccattggtattt   5700
       ............................................................
5701   attgtagctgcacatatttaaagacaaaatgtctgaaggcattttgtcatgaatatgttt   5760
       ............................................................
5761   tgtataactgaggcttcaactcttcagatattctgctccttacacaagtacttgttgagt   5820
       ............................................................
5821   aagagggaagccgggtccatcacgccaggtcacatgtaactgctgtctcaatgagtcttc   5880
       ............................................................
5881   ccactctctggacactacctagtttaatttccatcgtacataaagatagttgttccacaa   5940
       ............................................................
5941   gcaaatatggtcagaagcctcaagtgaagggtattgcagcttgtaaaagtaatttccaaa   6000
       ............................................................
6001   atgaaacacattcatcataaacaaagcacaaacacgtgtagcggtttatactttcggttt   6060
       ............................................................
6061   aatctcaatttgtctttttcccctggactagaaatccagtatagtttgccattaatttat   6120
       ............................................................
6121   tgactctgggtttggaccatgctctgtagtgtagctgcacgtacgtcctggtactgtgtc   6180
       ............................................................
6181   ctctgacctttacgttccataggcttcagaaggacaaccgtggagatcacccttgcataa   6240
       ............................................................
6241   actctaatttgcacacttcacagctactacccgtgcagcaattgctttatgcggctgtaa   6300
       ............................................................
6301   tccataacccgtgaagacagcacatcatctaaatctcattccaaataatatttctgtgta   6360
       ............................................................
6361   gtgttagctgtgaatttaccctgtacagctgtatctctataaatataattccatgtatta   6420
       ............................................................
6421   atagtcacagaaagactgtaagtgagcaactatttttatgaaacgcaccactatggataa   6480
       ............................................................
6481   attaacttttacagaaatcttgtttactgtatgatattctaaaacactgtcaaataaaat   6540
       ............................................................
6541   atatatccaaaaatcttttctttttccagct                                6600
       ...............................