Imprinted Gene Databases

Mus musculus: Ctnna3

Catenin, alpha 3
Species Gene Aliases Location Status Expressed Allele
Homo sapiens CTNNA3 VR22, MGC26194, MGC75041  10q22.2  Provisional Data Maternal
Mus musculus Ctnna3 Vr22, Catna3, 4933408A16  10 B4-B5.1  Unknown Unknown
1      ggtttgaattccccgcccggaggctgagcgcaggtttctcaggaggaggccggaagccga     60
       ............................................................
61     ggtgtcgagcgacctcctgataggcaacATGTCGGCAGAAACGCCAATAACCCTGAATAT    120
       ............................M--S--A--E--T--P--I--T--L--N--M-
121    GGACACTCAGGATCTGCAGATCCAAACGTTCACTGTGGAGAAACTGCTGGAGCCTCTGAT    180
       -D--T--Q--D--L--Q--I--Q--T--F--T--V--E--K--L--L--E--P--L--I-
181    AATCCAGGTTACTACCCTGGTGAATTGTCCGCAGAATCCTTCCAACAGGAAGAAAGGACG    240
       -I--Q--V--T--T--L--V--N--C--P--Q--N--P--S--N--R--K--K--G--R-
241    TTCAAAGAGAGCCAGAGTTCTTCTAGCTTCCGTGGAGGAAGCAACTTGGAATTTGTTAGA    300
       -S--K--R--A--R--V--L--L--A--S--V--E--E--A--T--W--N--L--L--D-
301    CAAGGGGGAGATGATTGCTAAGGAAGCCACGGTTTTAAAGGAAGAGCTGGCAGCTGCACT    360
       -K--G--E--M--I--A--K--E--A--T--V--L--K--E--E--L--A--A--A--L-
361    CCAGGAAGTTCGAAAAGAGAGCAAAGCTCTGAAGGTATCAGCTGAGAGATTTACAGACGA    420
       -Q--E--V--R--K--E--S--K--A--L--K--V--S--A--E--R--F--T--D--D-
421    CCCCTGTTACCTCCCGAAAAGGGAGGCCGTGGTTCAAGCCGCCCGCGCCCTGTTGGCAGC    480
       -P--C--Y--L--P--K--R--E--A--V--V--Q--A--A--R--A--L--L--A--A-
481    AGTTACAAGACTCCTTGTTCTTGCCGACATGATTGATGTCATGTGCCTCTTGCAGCATGT    540
       -V--T--R--L--L--V--L--A--D--M--I--D--V--M--C--L--L--Q--H--V-
541    GTCATCTTTCCAAAGAACATTCGAGTCTCTCAAAAATGTTTCCAACAAGTCCGACCTCCA    600
       -S--S--F--Q--R--T--F--E--S--L--K--N--V--S--N--K--S--D--L--Q-
601    GAGAACCTACCAGAAGCTCGGGAAGGAGCTGGAAAGCCTGGATTATTTGGCCTTCAAACG    660
       -R--T--Y--Q--K--L--G--K--E--L--E--S--L--D--Y--L--A--F--K--R-
661    CCAGCAGGACCTAAAATCTCCAAGCCAGAGGGATGAAATTGCAGGGGCCCGGGCCACCTT    720
       -Q--Q--D--L--K--S--P--S--Q--R--D--E--I--A--G--A--R--A--T--L-
721    GAAGGAGAACTCCCCACTCCTGCATTCTATTTGTTCAGCATGCTTGGAACATTCCGATGT    780
       -K--E--N--S--P--L--L--H--S--I--C--S--A--C--L--E--H--S--D--V-
781    TGCTTCGCTCAAAGCCAGTAAGGACACCGTCTGTGAAGAGATCCAGAACGCTCTTGATGT    840
       -A--S--L--K--A--S--K--D--T--V--C--E--E--I--Q--N--A--L--D--V-
841    AATTTCAAATGCTTCCCAAGGCATCCAGAATGCGCCAGCGCCCCCTGAACCTCAGGCAGC    900
       -I--S--N--A--S--Q--G--I--Q--N--A--P--A--P--P--E--P--Q--A--A-
901    AACACTGGGAAGTGCTTTTGATGAGCTGGAGAACTTAATTGTCCTGAACCCACTCACAGT    960
       -T--L--G--S--A--F--D--E--L--E--N--L--I--V--L--N--P--L--T--V-
961    GACAGAGGAAGATGTAAGACCATCACTAGAGAAACGCCTAGAAGCCATCATCAGTGGGGC   1020
       -T--E--E--D--V--R--P--S--L--E--K--R--L--E--A--I--I--S--G--A-
1021   CGCACTGTTGGCCGACTCGTCCTGCACCAGGGACCTCCACCGGGAGCGGATTATCGCCGA   1080
       -A--L--L--A--D--S--S--C--T--R--D--L--H--R--E--R--I--I--A--E-
1081   GTGCAATGCCATCCGCCAGGCTCTCCAGGACCTGCTGACGGAGTACATGAGTAATACTGG   1140
       -C--N--A--I--R--Q--A--L--Q--D--L--L--T--E--Y--M--S--N--T--G-
1141   AAAAACAGAAAGGAGTAATACCCTGAATACTGCCATTGTCAACATGAGCAAGAAGACAAG   1200
       -K--T--E--R--S--N--T--L--N--T--A--I--V--N--M--S--K--K--T--R-
1201   AGACCTCCGCAGACAGCTCCGCAAAGCTATCATAGATCACATATCAGATTCTTTCTTGGA   1260
       -D--L--R--R--Q--L--R--K--A--I--I--D--H--I--S--D--S--F--L--D-
1261   TACAACAGTTCCACTCCTGGTCCTCATTGAAGCTGCGAAGAATGGCCGAGTCAAGGAAAT   1320
       -T--T--V--P--L--L--V--L--I--E--A--A--K--N--G--R--V--K--E--I-
1321   CAAAGACTATGCTGCCATATTTCATGAGCACACTGGCAGGCTCGTGGAGGTGGCAAATCT   1380
       -K--D--Y--A--A--I--F--H--E--H--T--G--R--L--V--E--V--A--N--L-
1381   GGCTTGTTCCATGTCAACGAATAAAGATGGGATTAAAATCGTCAGAATTGCAGCCAATCA   1440
       -A--C--S--M--S--T--N--K--D--G--I--K--I--V--R--I--A--A--N--H-
1441   CCTGGAGACCCTGTGTCCACAGATCATAAATGCTGCACTTGCTTTGGCATCAAGACCCAA   1500
       -L--E--T--L--C--P--Q--I--I--N--A--A--L--A--L--A--S--R--P--K-
1501   GAGTCAAGTGGTCAAAAACACCATGGAAATGTACAAGCGCACATGGGAACACTACATCCA   1560
       -S--Q--V--V--K--N--T--M--E--M--Y--K--R--T--W--E--H--Y--I--H-
1561   CGTCCTCACTGAAGCTGTAGATGACATCACCAGCATTGACGACTTTCTGGCTGTATCTGA   1620
       -V--L--T--E--A--V--D--D--I--T--S--I--D--D--F--L--A--V--S--E-
1621   AAGCCACATCCTGGAAGATGTCAACAAATGCATTATAGCCTTGAGAGATCAGGATGCTGA   1680
       -S--H--I--L--E--D--V--N--K--C--I--I--A--L--R--D--Q--D--A--D-
1681   TAATTTAGACCGAGCTGCCGGTGCCATCAGAGGACGGGCCGCAAGAGTAGCTCACATCGT   1740
       -N--L--D--R--A--A--G--A--I--R--G--R--A--A--R--V--A--H--I--V-
1741   TGCGGGTGAAATGGATAGTTACGAACCCGGCGCTTACACCGAAGGTGTGATGAGAAATGT   1800
       -A--G--E--M--D--S--Y--E--P--G--A--Y--T--E--G--V--M--R--N--V-
1801   CAACTTCCTTACAAGCACTGTGATCCCGGAGTTCGTGACACAAGTGAATGTGGCCCTAGA   1860
       -N--F--L--T--S--T--V--I--P--E--F--V--T--Q--V--N--V--A--L--D-
1861   TGCTTTAAGCAAGAACTCTCTGACTGCGCTTGATGATAATCAGTTTGTGGACATCTCCAA   1920
       -A--L--S--K--N--S--L--T--A--L--D--D--N--Q--F--V--D--I--S--K-
1921   GAAGATCTATGACACAATCCATGATATCAGGTGTTCGGTCATGATGATTCGGACACCAGA   1980
       -K--I--Y--D--T--I--H--D--I--R--C--S--V--M--M--I--R--T--P--E-
1981   GGAACTAGAGGATGTTTCTGACCTTGAAGATGACCATGAGGTCCGTAGCCACACCAGCAT   2040
       -E--L--E--D--V--S--D--L--E--D--D--H--E--V--R--S--H--T--S--I-
2041   TCAGACAGAAGGGAAAACTGATCGGGCCAAGATGACTCAACTGCCTGAGGCAGAAAAGGA   2100
       -Q--T--E--G--K--T--D--R--A--K--M--T--Q--L--P--E--A--E--K--E-
2101   AAAGATTGCTGAGCAAGTCGCCGACTTCAAGAAGGTGAAGAGCAAGCTGGACGCTGAGAT   2160
       -K--I--A--E--Q--V--A--D--F--K--K--V--K--S--K--L--D--A--E--I-
2161   TGAGATATGGGATGACACAAGCAATGACATCATTGTTCTTGCCAAGAAGATGTGCATGAT   2220
       -E--I--W--D--D--T--S--N--D--I--I--V--L--A--K--K--M--C--M--I-
2221   CATGATGGAGATGACCGACTTCACGAGGGGGAAAGGACCACTAAAGCATACCACTGATGT   2280
       -M--M--E--M--T--D--F--T--R--G--K--G--P--L--K--H--T--T--D--V-
2281   AATCTATGCAGCTAAAATGATATCAGAGTCAGGATCAAGGATGGATGTTCTTGCTCGGCA   2340
       -I--Y--A--A--K--M--I--S--E--S--G--S--R--M--D--V--L--A--R--Q-
2341   GATTGCTAACCAGTGTCCAGATCCACCGTGCAAACAGGACTTGCTGGCTTACCTGGAACA   2400
       -I--A--N--Q--C--P--D--P--P--C--K--Q--D--L--L--A--Y--L--E--Q-
2401   GATTAAATTCTACTCCCACCAGCTGAAAATCTGCAGTCAAGTTAAAGCAGAGATCCAAAA   2460
       -I--K--F--Y--S--H--Q--L--K--I--C--S--Q--V--K--A--E--I--Q--N-
2461   TCTGGGGGGAGAACTCATCGTATCAGCTTTGGACAGTGTCACCTCCCTGATCCAGGCAGC   2520
       -L--G--G--E--L--I--V--S--A--L--D--S--V--T--S--L--I--Q--A--A-
2521   CAAGAATTTAATGAATGCTGTAGTGCAAACAGTGAAAATGTCATACATTGCCTCCACCAA   2580
       -K--N--L--M--N--A--V--V--Q--T--V--K--M--S--Y--I--A--S--T--K-
2581   GATCATCCGCATCCAGAGTTGTGCAGGACCCCGGCACCCAGTAGTCATGTGGAGGATGAA   2640
       -I--I--R--I--Q--S--C--A--G--P--R--H--P--V--V--M--W--R--M--K-
2641   GGCTCCGGCTAAGAAGCCCTTGATTAAAAGAGAGAAGCCAGAAGAAACATGGGTAGCTGT   2700
       -A--P--A--K--K--P--L--I--K--R--E--K--P--E--E--T--W--V--A--V-
2701   CAGAAGAGGCTCTGCCAAGAAAAAGATCCACCCAGTTCAAGTCATGAGTGAATTCAGAGG   2760
       -R--R--G--S--A--K--K--K--I--H--P--V--Q--V--M--S--E--F--R--G-
2761   GAGACAAGTCTACTGAataccctcatccactctagtgcccatttctacaccccaggctaa   2820
       -R--Q--V--Y--***............................................
2821   ccacactgctttatttcatggttcattggttctttaatttcaccaagtttcagagttaag   2880
       ............................................................
2881   ctcac                                                          2940
       .....