Imprinted Gene Databases

Homo sapiens: ZNF597

Zinc finger protein 597

Nakabayashi K et al., Hum Mol Genet 20: 3188-3197, 2011

Species Gene Aliases Location Status Expressed Allele
Homo sapiens ZNF597   16p13.3  Imprinted Maternal
1      ctcctgcgtaaaggagcatgagagcgtgggagttttgcagtggccgtggcgttcttcgtc     60
       ............................................................
61     gcgtctcggtcgggcgtcgctttctgcagctcctgtcagggagcgcgaggcctgttatta    120
       ............................................................
121    accgcggagcgctttgtcacgaagtccctgtggcgtcttgaagaaggcattccccacccg    180
       ............................................................
181    ccaaATGGCGTCCATGCCCCCGACGCCCGAGGCCCAGGGACCAATACTGTTTGAGGATCT    240
       ....M--A--S--M--P--P--T--P--E--A--Q--G--P--I--L--F--E--D--L-
241    GGCTGTGTATTTTTCTCAAGAGGAGTGCGTGACTCTGCACCCTGCCCAGAGGTCCCTCAG    300
       -A--V--Y--F--S--Q--E--E--C--V--T--L--H--P--A--Q--R--S--L--S-
301    CAAAGATGGTACAAAAGAGTCTTTGGAGGATGCGGCTTTGATGGGAGAGGAAGGCAAGCC    360
       -K--D--G--T--K--E--S--L--E--D--A--A--L--M--G--E--E--G--K--P-
361    TGAGATTAATCAGCAGTTAAGCCTAGAGTCTATGGAACTTGACGAGCTTGCCTTAGAAAA    420
       -E--I--N--Q--Q--L--S--L--E--S--M--E--L--D--E--L--A--L--E--K-
421    GTACCCCATTGCTGCACCCCTTGTCCCTTACCCAGAAAAATCCTCTGAGGATGGAGTTGG    480
       -Y--P--I--A--A--P--L--V--P--Y--P--E--K--S--S--E--D--G--V--G-
481    AAACCCTGAAGCGAAAATATTAAGTGGAACTCCCACTTACAAGAGAAGGGTCATCAGCCT    540
       -N--P--E--A--K--I--L--S--G--T--P--T--Y--K--R--R--V--I--S--L-
541    TTTAGTTACCATTGAAAACCACACCCCATTAGTAGAACTCTCTGAATATTTAGGAACCAA    600
       -L--V--T--I--E--N--H--T--P--L--V--E--L--S--E--Y--L--G--T--N-
601    CACACTTTCTGAAATTCTTGATTCTCCCTGGGAAGGAGCCAAAAATGTGTACAAATGTCC    660
       -T--L--S--E--I--L--D--S--P--W--E--G--A--K--N--V--Y--K--C--P-
661    TGAGTGTGACCAAAACTTCAGCGATCATTCATACCTAGTTTTGCATCAGAAAATTCATTC    720
       -E--C--D--Q--N--F--S--D--H--S--Y--L--V--L--H--Q--K--I--H--S-
721    AGGAGAGAAAAAACATAAATGTGGTGACTGTGGAAAGATCTTCAATCATAGAGCCAACCT    780
       -G--E--K--K--H--K--C--G--D--C--G--K--I--F--N--H--R--A--N--L-
781    GAGGACACACAGGAGAATCCATACTGGTGAGAAACCTTATAAGTGTGCCAAGTGCAGTGC    840
       -R--T--H--R--R--I--H--T--G--E--K--P--Y--K--C--A--K--C--S--A-
841    CAGCTTTCGCCAGCACTCTCATCTATCCCGACACATGAATAGCCACGTAAAGGAGAAGCC    900
       -S--F--R--Q--H--S--H--L--S--R--H--M--N--S--H--V--K--E--K--P-
901    CTATACATGTAGCATATGTGGTAGAGGTTTTATGTGGCTCCCAGGATTGGCACAGCATCA    960
       -Y--T--C--S--I--C--G--R--G--F--M--W--L--P--G--L--A--Q--H--Q-
961    GAAAAGCCACAGTGCTGAAAACACCTACGAATCTACTAACTGTGATAAACATTTTAATGA   1020
       -K--S--H--S--A--E--N--T--Y--E--S--T--N--C--D--K--H--F--N--E-
1021   GAAACCAAATCTTGCTTTGCCTGAGGAAACATTCGTATCAGGCCCCCAGTACCAGCACAC   1080
       -K--P--N--L--A--L--P--E--E--T--F--V--S--G--P--Q--Y--Q--H--T-
1081   TAAGTGCATGAAGAGCTTCAGGCAGTCCTTATATCCTGCCCTTTCCGAGAAGAGCCACGA   1140
       -K--C--M--K--S--F--R--Q--S--L--Y--P--A--L--S--E--K--S--H--D-
1141   CGAGGACTCTGAACGCTGCAGCGATGATGGGGACAATTTCTTCTCATTCTCAAAATTCAA   1200
       -E--D--S--E--R--C--S--D--D--G--D--N--F--F--S--F--S--K--F--K-
1201   GCCCTTACAGTGTCCTGACTGTGACATGACCTTTCCTTGTTTCTCTGAGCTTATTTCCCA   1260
       -P--L--Q--C--P--D--C--D--M--T--F--P--C--F--S--E--L--I--S--H-
1261   TCAGAACATTCATACAGAGGAAAGGCCCCATAAGTGCAAAACATGCGAGGAAAGTTTTGC   1320
       -Q--N--I--H--T--E--E--R--P--H--K--C--K--T--C--E--E--S--F--A-
1321   TTTGGACTCAGAACTTGCATGCCACCAGAAGAGCCACATGCTAGCGGAACCTTTTAAATG   1380
       -L--D--S--E--L--A--C--H--Q--K--S--H--M--L--A--E--P--F--K--C-
1381   TACCGTGTGTGGGAAAACTTTCAAGTCGAATTTGCATCTCATTACTCATAAGCGAACTCA   1440
       -T--V--C--G--K--T--F--K--S--N--L--H--L--I--T--H--K--R--T--H-
1441   CATAAAAAACACCACGTAAagtaaatataacaaattgttattagtgattgggcttttcag   1500
       -I--K--N--T--T--***.........................................
1501   tatctgtatggtgggaagcagttactgtatatgtcccaggcaatgtgctaagcactttac   1560
       ............................................................
1561   acacattcccatgtaatacttaattctcagcacaaccttgatttaggcagtatcatttcc   1620
       ............................................................
1621   attttataagtagggatgcaaaatccgtgtcactaaactagtgaatgaacccaggatttg   1680
       ............................................................
1681   aactcagttactgtacaactgtgagccagaagaagatacacaacttttgtttaaattcaa   1740
       ............................................................
1741   ttttcattaaaatgaaggctcttgctaaagttaaaaaaaaaaaaaaaaaaaaaaaaaaaa   1800
       ............................................................
1801   aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa                         1860
       ......................................