Imprinted Gene Databases

Homo sapiens: WT1

Wilms tumor 1

Only AWT1 is imprinted. Little et al. Oncogene 7: 635-641, 1992; Dallosso et al. Hum Mol Genet 13: 405, 2004; Hancock et al. Hum Mol Genet 16: 343-354, 2007

Species Gene Aliases Location Status Expressed Allele
Homo sapiens WT1 GUD, AWT1, WAGR, WT33, NPHS4, WIT-2, EWS-WT1  11p13  Imprinted Paternal
Mus musculus Wt1 Wt-1, D630046I19Rik  2 58.0 cM  Tissue Dependent Maternal
1      agctggggtaaggagttcaaggcagcgcccacacccgggggctctccgcaacccgaccgc     60
       ............................................................
61     ctgtccgctcccccacttcccgccctccctcccacctactcattcacccacccacccacc    120
       ............................................................
121    cagagccgggacggcagcccaggcgcccgggccccgccgtctcctcgccgcgatcctgga    180
       ............................................................
181    cttcctcttgCTGCAGGACCCGGCTTCCACGTGTGTCCCGGAGCCGGCGTCTCAGCACAC    240
       ..........M--Q--D--P--A--S--T--C--V--P--E--P--A--S--Q--H--T-
241    GCTCCGCTCCGGGCCTGGGTGCCTACAGCAGCCAGAGCAGCAGGGAGTCCGGGACCCGGG    300
       -L--R--S--G--P--G--C--L--Q--Q--P--E--Q--Q--G--V--R--D--P--G-
301    CGGCATCTGGGCCAAGTTAGGCGCCGCCGAGGCCAGCGCTGAACGTCTCCAGGGCCGGAG    360
       -G--I--W--A--K--L--G--A--A--E--A--S--A--E--R--L--Q--G--R--R-
361    GAGCCGCGGGGCGTCCGGGTCTGAGCCGCAGCAAATGGGCTCCGACGTGCGGGACCTGAA    420
       -S--R--G--A--S--G--S--E--P--Q--Q--M--G--S--D--V--R--D--L--N-
421    CGCGCTGCTGCCCGCCGTCCCCTCCCTGGGTGGCGGCGGCGGCTGTGCCCTGCCTGTGAG    480
       -A--L--L--P--A--V--P--S--L--G--G--G--G--G--C--A--L--P--V--S-
481    CGGCGCGGCGCAGTGGGCGCCGGTGCTGGACTTTGCGCCCCCGGGCGCTTCGGCTTACGG    540
       -G--A--A--Q--W--A--P--V--L--D--F--A--P--P--G--A--S--A--Y--G-
541    GTCGTTGGGCGGCCCCGCGCCGCCACCGGCTCCGCCGCCACCCCCGCCGCCGCCGCCTCA    600
       -S--L--G--G--P--A--P--P--P--A--P--P--P--P--P--P--P--P--P--H-
601    CTCCTTCATCAAACAGGAGCCGAGCTGGGGCGGCGCGGAGCCGCACGAGGAGCAGTGCCT    660
       -S--F--I--K--Q--E--P--S--W--G--G--A--E--P--H--E--E--Q--C--L-
661    GAGCGCCTTCACTGTCCACTTTTCCGGCCAGTTCACTGGCACAGCCGGAGCCTGTCGCTA    720
       -S--A--F--T--V--H--F--S--G--Q--F--T--G--T--A--G--A--C--R--Y-
721    CGGGCCCTTCGGTCCTCCTCCGCCCAGCCAGGCGTCATCCGGCCAGGCCAGGATGTTTCC    780
       -G--P--F--G--P--P--P--P--S--Q--A--S--S--G--Q--A--R--M--F--P-
781    TAACGCGCCCTACCTGCCCAGCTGCCTCGAGAGCCAGCCCGCTATTCGCAATCAGGGTTA    840
       -N--A--P--Y--L--P--S--C--L--E--S--Q--P--A--I--R--N--Q--G--Y-
841    CAGCACGGTCACCTTCGACGGGACGCCCAGCTACGGTCACACGCCCTCGCACCATGCGGC    900
       -S--T--V--T--F--D--G--T--P--S--Y--G--H--T--P--S--H--H--A--A-
901    GCAGTTCCCCAACCACTCATTCAAGCATGAGGATCCCATGGGCCAGCAGGGCTCGCTGGG    960
       -Q--F--P--N--H--S--F--K--H--E--D--P--M--G--Q--Q--G--S--L--G-
961    TGAGCAGCAGTACTCGGTGCCGCCCCCGGTCTATGGCTGCCACACCCCCACCGACAGCTG   1020
       -E--Q--Q--Y--S--V--P--P--P--V--Y--G--C--H--T--P--T--D--S--C-
1021   CACCGGCAGCCAGGCTTTGCTGCTGAGGACGCCCTACAGCAGTGACAATTTATACCAAAT   1080
       -T--G--S--Q--A--L--L--L--R--T--P--Y--S--S--D--N--L--Y--Q--M-
1081   GACATCCCAGCTTGAATGCATGACCTGGAATCAGATGAACTTAGGAGCCACCTTAAAGGG   1140
       -T--S--Q--L--E--C--M--T--W--N--Q--M--N--L--G--A--T--L--K--G-
1141   CCACAGCACAGGGTACGAGAGCGATAACCACACAACGCCCATCCTCTGCGGAGCCCAATA   1200
       -H--S--T--G--Y--E--S--D--N--H--T--T--P--I--L--C--G--A--Q--Y-
1201   CAGAATACACACGCACGGTGTCTTCAGAGGCATTCAGGATGTGCGACGTGTGCCTGGAGT   1260
       -R--I--H--T--H--G--V--F--R--G--I--Q--D--V--R--R--V--P--G--V-
1261   AGCCCCGACTCTTGTACGGTCGGCATCTGAGACCAGTGAGAAACGCCCCTTCATGTGTGC   1320
       -A--P--T--L--V--R--S--A--S--E--T--S--E--K--R--P--F--M--C--A-
1321   TTACCCAGGCTGCAATAAGAGATATTTTAAGCTGTCCCACTTACAGATGCACAGCAGGAA   1380
       -Y--P--G--C--N--K--R--Y--F--K--L--S--H--L--Q--M--H--S--R--K-
1381   GCACACTGGTGAGAAACCATACCAGTGTGACTTCAAGGACTGTGAACGAAGGTTTTCTCG   1440
       -H--T--G--E--K--P--Y--Q--C--D--F--K--D--C--E--R--R--F--S--R-
1441   TTCAGACCAGCTCAAAAGACACCAAAGGAGACATACAGGTGTGAAACCATTCCAGTGTAA   1500
       -S--D--Q--L--K--R--H--Q--R--R--H--T--G--V--K--P--F--Q--C--K-
1501   AACTTGTCAGCGAAAGTTCTCCCGGTCCGACCACCTGAAGACCCACACCAGGACTCATAC   1560
       -T--C--Q--R--K--F--S--R--S--D--H--L--K--T--H--T--R--T--H--T-
1561   AGGTGAAAAGCCCTTCAGCTGTCGGTGGCCAAGTTGTCAGAAAAAGTTTGCCCGGTCAGA   1620
       -G--E--K--P--F--S--C--R--W--P--S--C--Q--K--K--F--A--R--S--D-
1621   TGAATTAGTCCGCCATCACAACATGCATCAGAGAAACATGACCAAACTCCAGCTGGCGCT   1680
       -E--L--V--R--H--H--N--M--H--Q--R--N--M--T--K--L--Q--L--A--L-
1681   TTGAggggtctccctcggggaccgttcagtgtcccaggcagcacagtgtgtgaactgctt   1740
       -***........................................................
1741   tcaagtctgactctccactcctcctcactaaaaaggaaacttcagttgatcttcttcatc   1800
       ............................................................
1801   caacttccaagacaagataccggtgcttctggaaactaccaggtgtgcctggaagagttg   1860
       ............................................................
1861   gtctctgccctgcctacttttagttgactcacaggccctggagaagcagctaacaatgtc   1920
       ............................................................
1921   tggttagttaaaagcccattgccatttggtgtggattttctactgtaagaagagccatag   1980
       ............................................................
1981   ctgatcatgtccccctgacccttcccttctttttttatgctcgttttcgctggggatgga   2040
       ............................................................
2041   attattgtaccattttctatcatggaatatttataggccagggcatgtgtatgtgtctgc   2100
       ............................................................
2101   taatgtaaactttgtcatggtttccatttactaacagcaacagcaagaaataaatcagag   2160
       ............................................................
2161   agcaaggcatcgggggtgaatcttgtctaacattcccgaggtcagccaggctgctaacct   2220
       ............................................................
2221   ggaaagcaggatgtagttctgccaggcaacttttaaagctcatgcatttcaagcagctga   2280
       ............................................................
2281   agaaaaaatcagaactaaccagtacctctgtatagaaatctaaaagaattttaccattca   2340
       ............................................................
2341   gttaattcaatgtgaacactggcacactgctcttaagaaactatgaagatctgagatttt   2400
       ............................................................
2401   tttgtgtatgtttttgactcttttgagtggtaatcatatgtgtctttatagatgtacata   2460
       ............................................................
2461   cctccttgcacaaatggaggggaattcattttcatcactgggagtgtccttagtgtataa   2520
       ............................................................
2521   aaaccatgctggtatatggcttcaagttgtaaaaatgaaagtgactttaaaagaaaatag   2580
       ............................................................
2581   gggatggtccaggatctccactgataagactgtttttaagtaacttaaggacctttgggt   2640
       ............................................................
2641   ctacaagtatatgtgaaaaaaatgagacttactgggtgaggaaatccattgtttaaagat   2700
       ............................................................
2701   ggtcgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgttgtgttgtgttttgttttttaa   2760
       ............................................................
2761   gggagggaatttattatttaccgttgcttgaaattactgtgtaaatatatgtctgataat   2820
       ............................................................
2821   gatttgctctttgacaactaaaattaggactgtataagtactagatgcatcactgggtgt   2880
       ............................................................
2881   tgatcttacaagatattgatgataacacttaaaattgtaacctgcatttttcactttgct   2940
       ............................................................
2941   ctcaattaaagtctattcaaaaggaaaaaaaaaaaaa                          3000
       .....................................