Imprinted Gene Databases

Homo sapiens: USP29

Ubiquitin specific peptidase 29
Species Gene Aliases Location Status Expressed Allele
Homo sapiens USP29 MGC163266, MGC163270, HOM-TES-84/86  19q13.43  Unknown Unknown
Bos taurus USP29   18  Imprinted Paternal
Mus musculus Usp29 Ocat  7 6.5 cM  Imprinted Paternal
1      aggctcatgcctgtaatcccagcactttgggaggccgaggcgggaggatcgcttgtgccc     60
       ............................................................
61     aggagttggagaccagcctgggcaacatagcgctatggagtctaatccaggcactttgga    120
       ............................................................
121    aggctgaggctggaggatcgattgaggccaggagtttgggaccaccctgggcaacatagc    180
       ............................................................
181    aagatctcatttctgaaaaaagaattatcatccactcacccagaacagctctccaaactt    240
       ............................................................
241    aacagccgtggcagtcagagctctgcctgcagtgtgaccatggacagctctccaaagctt    300
       ............................................................
301    aaacttcagtaaattgactcaagtttcttcggaaagaactgttacataaagaaaggATGA    360
       ........................................................M--I
361    TATCTCTAAAGGTATGTGGATTCATCCAAATTTGGAGCCAGAAGACTGGGATGACTAAGC    420
       --S--L--K--V--C--G--F--I--Q--I--W--S--Q--K--T--G--M--T--K--L
421    TGAAAGAAGCTCTCATTGAAACAGTGCAAAGACAAAAGGAAATTAAACTGGTGGTCACTT    480
       --K--E--A--L--I--E--T--V--Q--R--Q--K--E--I--K--L--V--V--T--F
481    TCAAATCTGGAAAATTTATAAGAATTTTTCAGCTGAGCAACAACATTAGAAGTGTGGTCC    540
       --K--S--G--K--F--I--R--I--F--Q--L--S--N--N--I--R--S--V--V--L
541    TTAGACATTGTAAAAAAAGACAAAGTCACCTGCGTTTAACTTTGAAAAACAACGTGTTCT    600
       --R--H--C--K--K--R--Q--S--H--L--R--L--T--L--K--N--N--V--F--L
601    TGTTTATTGACAAATTATCCTACAGAGATGCTAAACAGTTGAATATGTTCCTGGACATAA    660
       --F--I--D--K--L--S--Y--R--D--A--K--Q--L--N--M--F--L--D--I--I
661    TCCACCAAAACAAATCTCAGCAACCCATGAAATCTGATGATGATTGGAGTGTGTTTGAAA    720
       --H--Q--N--K--S--Q--Q--P--M--K--S--D--D--D--W--S--V--F--E--S
721    GCAGGAATATGCTGAAGGAAATTGACAAAACTTCATTTTACAGCATTTGTAACAAGCCAA    780
       --R--N--M--L--K--E--I--D--K--T--S--F--Y--S--I--C--N--K--P--S
781    GTTATCAGAAGATGCCTTTGTTTATGTCAAAATCACCAACACATGTGAAAAAGGGGATAT    840
       --Y--Q--K--M--P--L--F--M--S--K--S--P--T--H--V--K--K--G--I--L
841    TAGAAAATCAAGGTGGGAAGGGGCAAAACACACTATCATCTGATGTACAGACAAATGAGG    900
       --E--N--Q--G--G--K--G--Q--N--T--L--S--S--D--V--Q--T--N--E--D
901    ACATTCTGAAGGAAGATAACCCTGTACCAAACAAGAAATATAAGACAGATTCCTTGAAAT    960
       --I--L--K--E--D--N--P--V--P--N--K--K--Y--K--T--D--S--L--K--Y
961    ATATACAAAGCAATAGGAAGAACCCATCAAGTTTAGAGGATTTAGAAAAAGATAGAGATT   1020
       --I--Q--S--N--R--K--N--P--S--S--L--E--D--L--E--K--D--R--D--L
1021   TGAAACTCGGGCCTTCATTCAATACCAACTGTAATGGAAATCCTAACCTAGATGAGACTG   1080
       --K--L--G--P--S--F--N--T--N--C--N--G--N--P--N--L--D--E--T--V
1081   TTCTTGCAACCCAGACTCTCAATGCCAAAAATGGTTTGACATCTCCATTGGAACCAGAGC   1140
       --L--A--T--Q--T--L--N--A--K--N--G--L--T--S--P--L--E--P--E--H
1141   ACAGCCAGGGTGACCCAAGATGCAACAAAGCCCAGGTGCCTCTTGACTCTCATTCACAGC   1200
       --S--Q--G--D--P--R--C--N--K--A--Q--V--P--L--D--S--H--S--Q--Q
1201   AACTGCAGCAGGGGTTCCCCAATTTGGGAAACACCTGTTACATGAATGCAGTTTTACAAT   1260
       --L--Q--Q--G--F--P--N--L--G--N--T--C--Y--M--N--A--V--L--Q--S
1261   CGCTATTTGCAATTCCATCTTTTGCTGATGACTTACTCACTCAAGGTGTCCCATGGGAAT   1320
       --L--F--A--I--P--S--F--A--D--D--L--L--T--Q--G--V--P--W--E--Y
1321   ATATTCCCTTTGAGGCTCTTATTATGACCTTGACCCAGCTGCTTGCTTTGAAAGATTTCT   1380
       --I--P--F--E--A--L--I--M--T--L--T--Q--L--L--A--L--K--D--F--C
1381   GTAGTACAAAGATCAAGAGAGAATTACTTGGGAATGTTAAAAAAGTCATTTCAGCAGTTG   1440
       --S--T--K--I--K--R--E--L--L--G--N--V--K--K--V--I--S--A--V--A
1441   CAGAAATATTTTCTGGCAACATGCAGAATGATGCTCATGAGTTTTTAGGTCAGTGTTTAG   1500
       --E--I--F--S--G--N--M--Q--N--D--A--H--E--F--L--G--Q--C--L--D
1501   ACCAGCTGAAAGAAGACATGGAAAAATTAAATGCCACTTTGAATACTGGGAAAGAATGTG   1560
       --Q--L--K--E--D--M--E--K--L--N--A--T--L--N--T--G--K--E--C--G
1561   GGGATGAAAATTCATCTCCACAAATGCATGTTGGTAGTGCTGCCACCAAAGTGTTTGTTT   1620
       --D--E--N--S--S--P--Q--M--H--V--G--S--A--A--T--K--V--F--V--C
1621   GCCCTGTTGTTGCTAATTTTGAGTTTGAATTGCAGCTCTCCCTTATTTGTAAAGCTTGTG   1680
       --P--V--V--A--N--F--E--F--E--L--Q--L--S--L--I--C--K--A--C--G
1681   GTCATGCTGTTCTCAAGGTAGAACCTAATAATTATCTCTCCATCAACCTGCACCAAGAAA   1740
       --H--A--V--L--K--V--E--P--N--N--Y--L--S--I--N--L--H--Q--E--T
1741   CAAAACCACTTCCTTTGTCCATTCAGAATTCTTTAGATCTTTTCTTTAAAGAAGAAGAGC   1800
       --K--P--L--P--L--S--I--Q--N--S--L--D--L--F--F--K--E--E--E--L
1801   TTGAATATAACTGTCAGATGTGTAAGCAGAAGAGTTGTGTTGCAAGGCATACATTTAGTA   1860
       --E--Y--N--C--Q--M--C--K--Q--K--S--C--V--A--R--H--T--F--S--R
1861   GGCTCTCCAGGGTCCTTATCATTCATCTGAAACGCTATAGCTTCAACAATGCTTGGTTGC   1920
       --L--S--R--V--L--I--I--H--L--K--R--Y--S--F--N--N--A--W--L--L
1921   TGGTGAAGAATAACGAGCAAGTTTATATTCCCAAATCTTTAAGTTTATCTTCTTATTGCA   1980
       --V--K--N--N--E--Q--V--Y--I--P--K--S--L--S--L--S--S--Y--C--N
1981   ATGAAAGCACCAAACCACCTCTTCCCTTGAGCAGTAGTGCACCTGTTGGGAAATGTGAAG   2040
       --E--S--T--K--P--P--L--P--L--S--S--S--A--P--V--G--K--C--E--V
2041   TCCTGGAAGTCTCTCAGGAGATGATTTCTGAGATCAACAGCCCATTGACACCATCAATGA   2100
       --L--E--V--S--Q--E--M--I--S--E--I--N--S--P--L--T--P--S--M--K
2101   AGCTGACCTCAGAATCCAGTGATTCCCTGGTTCTACCCGTTGAACCAGACAAGAATGCCG   2160
       --L--T--S--E--S--S--D--S--L--V--L--P--V--E--P--D--K--N--A--D
2161   ACCTACAAAGATTCCAGAGAGACTGTGGAGATGCAAGCCAAGAGCAGCATCAGAGAGACC   2220
       --L--Q--R--F--Q--R--D--C--G--D--A--S--Q--E--Q--H--Q--R--D--L
2221   TGGAAAATGGCTCTGCACTAGAGTCAGAATTGGTCCACTTTAGAGATAGGGCAATCGGTG   2280
       --E--N--G--S--A--L--E--S--E--L--V--H--F--R--D--R--A--I--G--E
2281   AAAAGGAGCTTCCAGTGGCTGACTCACTGATGGACCAGGGAGACATTTCTCTTCCTGTGA   2340
       --K--E--L--P--V--A--D--S--L--M--D--Q--G--D--I--S--L--P--V--M
2341   TGTATGAAGATGGAGGGAAGCTGATCAGCAGCCCAGACACAAGGCTTGTCGAGGTTCATC   2400
       --Y--E--D--G--G--K--L--I--S--S--P--D--T--R--L--V--E--V--H--L
2401   TTCAAGAGGTGCCTCAACATCCAGAACTTCAGAAGTATGAGAAAACCAATACATTCGTAG   2460
       --Q--E--V--P--Q--H--P--E--L--Q--K--Y--E--K--T--N--T--F--V--E
2461   AGTTCAATTTTGACAGTGTCACTGAGTCCACCAATGGCTTTTATGACTGTAAAGAAAACA   2520
       --F--N--F--D--S--V--T--E--S--T--N--G--F--Y--D--C--K--E--N--R
2521   GGATTCCAGAAGGATCTCAAGGAATGGCTGAACAGCTCCAGCAGTGTATTGAGGAGAGCA   2580
       --I--P--E--G--S--Q--G--M--A--E--Q--L--Q--Q--C--I--E--E--S--I
2581   TCATAGATGAATTTCTTCAGCAGGCACCACCTCCAGGTGTTAGGAAGCTGGATGCCCAGG   2640
       --I--D--E--F--L--Q--Q--A--P--P--P--G--V--R--K--L--D--A--Q--E
2641   AACATACAGAAGAGACCCTCAATCAGTCTACAGAATTAAGACTTCAAAAGGCTGACCTGA   2700
       --H--T--E--E--T--L--N--Q--S--T--E--L--R--L--Q--K--A--D--L--N
2701   ATCACCTTGGGGCACTGGGTTCTGACAACCCAGGAAACAAAAACATTTTAGATGCAGAGA   2760
       --H--L--G--A--L--G--S--D--N--P--G--N--K--N--I--L--D--A--E--N
2761   ACACAAGAGGTGAAGCCAAGGAACTAACAAGAAACGTGAAGATGGGGGATCCTCTCCAGG   2820
       --T--R--G--E--A--K--E--L--T--R--N--V--K--M--G--D--P--L--Q--A
2821   CCTACAGACTCATCAGTGTTGTCAGCCATATCGGGAGCTCCCCAAATTCAGGCCATTACA   2880
       --Y--R--L--I--S--V--V--S--H--I--G--S--S--P--N--S--G--H--Y--I
2881   TCAGCGATGTGTATGACTTTCAGAAGCAGGCCTGGTTCACATACAACGATCTATGTGTAT   2940
       --S--D--V--Y--D--F--Q--K--Q--A--W--F--T--Y--N--D--L--C--V--S
2941   CAGAAATCTCAGAGACCAAAATGCAGGAGGCGAGGCTTCACTCTGGGTATATCTTCTTTT   3000
       --E--I--S--E--T--K--M--Q--E--A--R--L--H--S--G--Y--I--F--F--Y
3001   ACATGCACAATGGGATTTTTGAGGAGCTGTTAAGAAAAGCAGAGAACTCTCGGCTACCTA   3060
       --M--H--N--G--I--F--E--E--L--L--R--K--A--E--N--S--R--L--P--S
3061   GCACACAGGCAGGGGTGATCCCTCAGGGGGAATACGAAGGTGACTCTTTGTACAGACCTG   3120
       --T--Q--A--G--V--I--P--Q--G--E--Y--E--G--D--S--L--Y--R--P--A
3121   CTTGAcagactcactcggcctcacttcatccttgcaaagagaatcctgtacttcatcctt   3180
       --***.......................................................
3181   gcaaagagaatcctgtacttcactcagaatgaaggaacaagtatctcaggatgaaatctc   3240
       ............................................................
3241   aatgaaaaacacttattttgggggaatatctattttaactgcttcagacacctagatccc   3300
       ............................................................
3301   agaactcaggcgcatatgcatattttccctgcaagattagaatggtgctcttcacgtttt   3360
       ............................................................
3361   gacggtggttttcaaaatgttgttcttcaaccagcaacagcaacagctagggactgatta   3420
       ............................................................
3421   gaaatgcaaattcttgggtcactctctagaccaactgatgcagaaacaggaggtgtgagc   3480
       ............................................................
3481   cagcaatcagatggagattctagtgctcatgaaagtttgaagaacactggtaatgtgtgg   3540
       ............................................................
3541   agtatcttggtgtattttgctactgttgatatggattgcttatgttatataaacgatttt   3600
       ............................................................
3601   cattaaa                                                        3660
       .......