Imprinted Gene Databases

Homo sapiens: TSPAN32

Tetraspanin 32
Species Gene Aliases Location Status Expressed Allele
Mus musculus Tspan32 Art-1, Phemx, Tssc6, AW208513, BB235973, D7Wsu37e  7 69.0 cM  Not Imprinted Biallelic
Homo sapiens TSPAN32 ART1, PHMX, PHEMX, TSSC6, FLJ17158, FLJ97586, MGC22455  11p15.5  Not Imprinted Biallelic
1      agggcgatgttgacagacagacagaggggcggatgcagcctacctcctgggcagtgagct     60
       ............................................................
61     gcggtctgaggcccctgcccagctggaaaccacagggaggggaagggaggggaggagagg    120
       ............................................................
121    agaggagaggaaccgtcATGGGGCCTTGGAGTCGAGTCAGGGTTGCCAAATGCCAGATGC    180
       .................M--G--P--W--S--R--V--R--V--A--K--C--Q--M--L
181    TGGTCACCTGCTTCTTTATCTTGCTGCTGGGCCTCTCTGTGGCCACCATGGTGACTCTTA    240
       --V--T--C--F--F--I--L--L--L--G--L--S--V--A--T--M--V--T--L--T
241    CCTACTTCGGGGCCCACTTTGCTGTCATCCGCCGAGCGTCCCTGGAGAAGAACCCGTACC    300
       --Y--F--G--A--H--F--A--V--I--R--R--A--S--L--E--K--N--P--Y--Q
301    AGGCTGTGCACCAATGGGCCTTCTCTGCGGGGTTGAGCCTGGTGGGCCTCCTGACTCTGG    360
       --A--V--H--Q--W--A--F--S--A--G--L--S--L--V--G--L--L--T--L--G
361    GAGCCGTGCTGAGCGCTGCAGCCACCGTGAGGGAGGCCCAGGGCCTCATGGCAGGGGGCT    420
       --A--V--L--S--A--A--A--T--V--R--E--A--Q--G--L--M--A--G--G--F
421    TCCTGTGCTTCTCCCTGGCGTTCTGCGCACAGGTGCAGGTGGTGTTCTGGAGACTCCACA    480
       --L--C--F--S--L--A--F--C--A--Q--V--Q--V--V--F--W--R--L--H--S
481    GCCCCACCCAGGTGGAGGACGCCATGCTGGACACCTACGACCTGGTATATGAGCAGGCGA    540
       --P--T--Q--V--E--D--A--M--L--D--T--Y--D--L--V--Y--E--Q--A--M
541    TGAAAGGTACGTCCCACGTCCGGCGGCAGGAGCTGGCGGCCATCCAGGACGTGTTTCTGT    600
       --K--G--T--S--H--V--R--R--Q--E--L--A--A--I--Q--D--V--F--L--C
601    GCTGTGGGAAGAAGTCTCCTTTCAGCCGTCTGGGGAGCACAGAGGCTGACCTGTGTCAGG    660
       --C--G--K--K--S--P--F--S--R--L--G--S--T--E--A--D--L--C--Q--G
661    GAGAGGAGGCGGCGAGAGAGGACTGCCTTCAGGGCATCCGGAGCTTCCTGAGGACACACC    720
       --E--E--A--A--R--E--D--C--L--Q--G--I--R--S--F--L--R--T--H--Q
721    AGCAGGTCGCCTCCAGCCTGACCAGCATCGGCCTGGCCCTCACGGTGTCCGCCTTGCTCT    780
       --Q--V--A--S--S--L--T--S--I--G--L--A--L--T--V--S--A--L--L--F
781    TCAGCTCCTTCCTGTGGTTTGCCATCCGCTGTGGCTGCAGCTTGGACCGCAAGGGCAAAT    840
       --S--S--F--L--W--F--A--I--R--C--G--C--S--L--D--R--K--G--K--Y
841    ACACCCTGACCCCACGAGCATGTGGCCGCCAGCCCCAGGAGCCCAGCCTCTTGAGATGCT    900
       --T--L--T--P--R--A--C--G--R--Q--P--Q--E--P--S--L--L--R--C--S
901    CCCAGGGTGGACCCACACATTGTCTCCACTCCGAAGCAGTTGCTATTGGTCCAAGAGGAT    960
       --Q--G--G--P--T--H--C--L--H--S--E--A--V--A--I--G--P--R--G--C
961    GCTCGGGTAGTCTTCGGTGGCTGCAGGAGAGCGATGCTGCGCCTCTGCCCCTCTCCTGCC   1020
       --S--G--S--L--R--W--L--Q--E--S--D--A--A--P--L--P--L--S--C--H
1021   ACCTGGCTGCCCACAGAGCTCTCCAGGGCAGAAGTCGCGGTGGGCTCAGTGGGTGCCCTG   1080
       --L--A--A--H--R--A--L--Q--G--R--S--R--G--G--L--S--G--C--P--E
1081   AGCGGGGTCTCTCAGACTGAcgtcaggccttggtgggctgcactctcacctggaggctcc   1140
       --R--G--L--S--D--***........................................
1141   ggggaagcatctgcctccaggaccattcaggctgttgacaagtcaactcctcatggctgt   1200
       ............................................................
1201   aggactgaggttcccaagtccttgtccctggtcctgtggtccctccaccttcaaaccagc   1260
       ............................................................
1261   aatggtgcattgagcaaattgtggtcaaatatacatcacatcaaatttaccatcttaacc   1320
       ............................................................
1321   attgttaagtgtatggtttgtggcattaaatacattcacattgttgtgcaaccatc       1380
       ........................................................