Imprinted Gene Databases

Homo sapiens: TH

Tyrosine hydroxylase
Species Gene Aliases Location Status Expressed Allele
Mus musculus Th   7 69.2 cM  Imprinted Maternal
Homo sapiens TH TYH, DYT14, DYT5b  11p15.5  Unknown Unknown
1      cggacctccacactgagccATGCCCACCCCCGACGCCACCACGCCACAGGCCAAGGGCTT     60
       ...................M--P--T--P--D--A--T--T--P--Q--A--K--G--F-
61     CCGCAGGGCCGTGTCTGAGCTGGACGCCAAGCAGGCAGAGGCCATCATGTCCCCGCGGTT    120
       -R--R--A--V--S--E--L--D--A--K--Q--A--E--A--I--M--S--P--R--F-
121    CATTGGGCGCAGGCAGAGCCTCATCGAGGACGCCCGCAAGGAGCGGGAGGCGGCGGTGGC    180
       -I--G--R--R--Q--S--L--I--E--D--A--R--K--E--R--E--A--A--V--A-
181    AGCAGCGGCCGCTGCAGTCCCCTCGGAGCCCGGGGACCCCCTGGAGGCTGTGGCCTTTGA    240
       -A--A--A--A--A--V--P--S--E--P--G--D--P--L--E--A--V--A--F--E-
241    GGAGAAGGAGGGGAAGGCCGTGCTAAACCTGCTCTTCTCCCCGAGGGCCACCAAGCCCTC    300
       -E--K--E--G--K--A--V--L--N--L--L--F--S--P--R--A--T--K--P--S-
301    GGCGCTGTCCCGAGCTGTGAAGGTGTTTGAGACGTTTGAAGCCAAAATCCACCATCTAGA    360
       -A--L--S--R--A--V--K--V--F--E--T--F--E--A--K--I--H--H--L--E-
361    GACCCGGCCCGCCCAGAGGCCGCGAGCTGGGGGCCCCCACCTGGAGTACTTCGTGCGCCT    420
       -T--R--P--A--Q--R--P--R--A--G--G--P--H--L--E--Y--F--V--R--L-
421    CGAGGTGCGCCGAGGGGACCTGGCCGCCCTGCTCAGTGGTGTGCGCCAGGTGTCAGAGGA    480
       -E--V--R--R--G--D--L--A--A--L--L--S--G--V--R--Q--V--S--E--D-
481    CGTGCGCAGCCCCGCGGGGCCCAAGGTCCCCTGGTTCCCAAGAAAAGTGTCAGAGCTGGA    540
       -V--R--S--P--A--G--P--K--V--P--W--F--P--R--K--V--S--E--L--D-
541    CAAGTGTCATCACCTGGTCACCAAGTTCGACCCTGACCTGGACTTGGACCACCCGGGCTT    600
       -K--C--H--H--L--V--T--K--F--D--P--D--L--D--L--D--H--P--G--F-
601    CTCGGACCAGGTGTACCGCCAGCGCAGGAAGCTGATTGCTGAGATCGCCTTCCAGTACAG    660
       -S--D--Q--V--Y--R--Q--R--R--K--L--I--A--E--I--A--F--Q--Y--R-
661    GCACGGCGACCCGATTCCCCGTGTGGAGTACACCGCCGAGGAGATTGCCACCTGGAAGGA    720
       -H--G--D--P--I--P--R--V--E--Y--T--A--E--E--I--A--T--W--K--E-
721    GGTCTACACCACGCTGAAGGGCCTCTACGCCACGCACGCCTGCGGGGAGCACCTGGAGGC    780
       -V--Y--T--T--L--K--G--L--Y--A--T--H--A--C--G--E--H--L--E--A-
781    CTTTGCTTTGCTGGAGCGCTTCAGCGGCTACCGGGAAGACAATATCCCCCAGCTGGAGGA    840
       -F--A--L--L--E--R--F--S--G--Y--R--E--D--N--I--P--Q--L--E--D-
841    CGTCTCCCGCTTCCTGAAGGAGCGCACGGGCTTCCAGCTGCGGCCTGTGGCCGGCCTGCT    900
       -V--S--R--F--L--K--E--R--T--G--F--Q--L--R--P--V--A--G--L--L-
901    GTCCGCCCGGGACTTCCTGGCCAGCCTGGCCTTCCGCGTGTTCCAGTGCACCCAGTATAT    960
       -S--A--R--D--F--L--A--S--L--A--F--R--V--F--Q--C--T--Q--Y--I-
961    CCGCCACGCGTCCTCGCCCATGCACTCCCCTGAGCCGGACTGCTGCCACGAGCTGCTGGG   1020
       -R--H--A--S--S--P--M--H--S--P--E--P--D--C--C--H--E--L--L--G-
1021   GCACGTGCCCATGCTGGCCGACCGCACCTTCGCGCAGTTCTCGCAGGACATTGGCCTGGC   1080
       -H--V--P--M--L--A--D--R--T--F--A--Q--F--S--Q--D--I--G--L--A-
1081   GTCCCTGGGGGCCTCGGATGAGGAAATTGAGAAGCTGTCCACGCTGTACTGGTTCACGGT   1140
       -S--L--G--A--S--D--E--E--I--E--K--L--S--T--L--Y--W--F--T--V-
1141   GGAGTTCGGGCTGTGTAAGCAGAACGGGGAGGTGAAGGCCTATGGTGCCGGGCTGCTGTC   1200
       -E--F--G--L--C--K--Q--N--G--E--V--K--A--Y--G--A--G--L--L--S-
1201   CTCCTACGGGGAGCTCCTGCACTGCCTGTCTGAGGAGCCTGAGATTCGGGCCTTCGACCC   1260
       -S--Y--G--E--L--L--H--C--L--S--E--E--P--E--I--R--A--F--D--P-
1261   TGAGGCTGCGGCCGTGCAGCCCTACCAAGACCAGACGTACCAGTCAGTCTACTTCGTGTC   1320
       -E--A--A--A--V--Q--P--Y--Q--D--Q--T--Y--Q--S--V--Y--F--V--S-
1321   TGAGAGCTTCAGTGACGCCAAGGACAAGCTCAGGAGCTATGCCTCACGCATCCAGCGCCC   1380
       -E--S--F--S--D--A--K--D--K--L--R--S--Y--A--S--R--I--Q--R--P-
1381   CTTCTCCGTGAAGTTCGACCCGTACACGCTGGCCATCGACGTGCTGGACAGCCCCCAGGC   1440
       -F--S--V--K--F--D--P--Y--T--L--A--I--D--V--L--D--S--P--Q--A-
1441   CGTGCGGCGCTCCCTGGAGGGTGTCCAGGATGAGCTGGACACCCTTGCCCATGCGCTGAG   1500
       -V--R--R--S--L--E--G--V--Q--D--E--L--D--T--L--A--H--A--L--S-
1501   TGCCATTGGCTAGgtgcacggcgtccctgagggcccttcccaacctcccctggtcctgca   1560
       -A--I--G--***...............................................
1561   ctgtcccggagctcaggccctggtgaggggctgggtcccgggtgccccccatgccctccc   1620
       ............................................................
1621   tgctgccaggctcccactgcccctgcacctgcttctcagcgcaacagctgtgtgtgcccg   1680
       ............................................................
1681   tggtgaggttgtgctgcctgtggtgaggtcctgtcctggctcccagggtcctgggggctg   1740
       ............................................................
1741   ctgcactgccctccgcccttccctgacactgtctgctgccccaatcaccgtcacaataaa   1800
       ............................................................
1801   agaaactgtggtctcta                                              1860
       .................