Imprinted Gene Databases

Homo sapiens: TFPI2

Tissue factor pathway inhibitor 2
Species Gene Aliases Location Status Expressed Allele
Mus musculus Tfpi2 AV000670, PP5/TFPI-2  6 1.0 cM  Imprinted Maternal
Homo sapiens TFPI2 PP5, REF1, TFPI-2, FLJ21164  7q22  Imprinted Maternal
1      agaaagccgcgcacctcctcccgccaggcgctttctcggacgccttgcccagcgggccgc     60
       ............................................................
61     ccgaccccctgcaccATGGACCCCGCTCGCCCCCTGGGGCTGTCGATTCTGCTGCTTTTC    120
       ...............M--D--P--A--R--P--L--G--L--S--I--L--L--L--F--
121    CTGACGGAGGCTGCACTGGGCGATGCTGCTCAGGAGCCAACAGGAAATAACGCGGAGATC    180
       L--T--E--A--A--L--G--D--A--A--Q--E--P--T--G--N--N--A--E--I--
181    TGTCTCCTGCCCCTAGACTACGGACCCTGCCGGGCCCTACTTCTCCGTTACTACTACGAC    240
       C--L--L--P--L--D--Y--G--P--C--R--A--L--L--L--R--Y--Y--Y--D--
241    AGGTACACGCAGAGCTGCCGCCAGTTCCTGTACGGGGGCTGCGAGGGCAACGCCAACAAT    300
       R--Y--T--Q--S--C--R--Q--F--L--Y--G--G--C--E--G--N--A--N--N--
301    TTCTACACCTGGGAGGCTTGCGACGATGCTTGCTGGAGGATAGAAAAAGTTCCCAAAGTT    360
       F--Y--T--W--E--A--C--D--D--A--C--W--R--I--E--K--V--P--K--V--
361    TGCCGGCTGCAAGTGAGTGTGGACGACCAGTGTGAGGGGTCCACAGAAAAGTATTTCTTT    420
       C--R--L--Q--V--S--V--D--D--Q--C--E--G--S--T--E--K--Y--F--F--
421    AATCTAAGTTCCATGACATGTGAAAAATTCTTTTCCGGTGGGTGTCACCGGAACCGGATT    480
       N--L--S--S--M--T--C--E--K--F--F--S--G--G--C--H--R--N--R--I--
481    GAGAACAGGTTTCCAGATGAAGCTACTTGTATGGGCTTCTGCGCACCAAAGAAAATTCCA    540
       E--N--R--F--P--D--E--A--T--C--M--G--F--C--A--P--K--K--I--P--
541    TCATTTTGCTACAGTCCAAAAGATGAGGGACTGTGCTCTGCCAATGTGACTCGCTATTAT    600
       S--F--C--Y--S--P--K--D--E--G--L--C--S--A--N--V--T--R--Y--Y--
601    TTTAATCCAAGATACAGAACCTGTGATGCTTTCACCTATACTGGCTGTGGAGGGAATGAC    660
       F--N--P--R--Y--R--T--C--D--A--F--T--Y--T--G--C--G--G--N--D--
661    AATAACTTTGTTAGCAGGGAGGATTGCAAACGTGCATGTGCAAAAGCTTTGAAAAAGAAA    720
       N--N--F--V--S--R--E--D--C--K--R--A--C--A--K--A--L--K--K--K--
721    AAGAAGATGCCAAAGCTTCGCTTTGCCAGTAGAATCCGGAAAATTCGGAAGAAGCAATTT    780
       K--K--M--P--K--L--R--F--A--S--R--I--R--K--I--R--K--K--Q--F--
781    TAAacattcttaatatgtcatcttgtttgtctttatggcttatttgcctttatggttgta    840
       ***.........................................................
841    tctgaagaataatatgacagcatgaggaaacaaatcattggtgatttattcaccagtttt    900
       ............................................................
901    tattaatacaagtcactttttcaaaaatttggatttttttatatataactagctgctatt    960
       ............................................................
961    caaatgtgagtctaccatttttaatttatggttcaactgtttgtgagactgaattcttgc   1020
       ............................................................
1021   aatgcataagatataaaagcaaatatgactcactcatttcttggggtcgtattcctgatt   1080
       ............................................................
1081   tcagaagaggatcataactgaaacaacataagacaatataatcatgtgcttttaacatat   1140
       ............................................................
1141   ttgagaataaaaaggactagcaaataaaacacaaaaaaaaaaaaaaaaaaaaaaaaaaaa   1200
       ............................................................
1201   aaa                                                            1260
       ...