Imprinted Gene Databases

Homo sapiens: SNURF

SNRPN upstream reading frame
Species Gene Aliases Location Status Expressed Allele
Homo sapiens SNURF   15q12  Imprinted Paternal
Mus musculus Snurf Snrpn, MGC18604, MGC30325, 2410045I01Rik  7 B5  Imprinted Paternal
1      cagagtggagcggccgccggagatgcctgacgcatctgtctgaggagcggtcagtgacgc     60
       ............................................................
61     gATGGAGCGGGCAAGGGATCGCTTACACCTGAGACGAACTACAGAACAGCACGTACCAGA    120
       .M--E--R--A--R--D--R--L--H--L--R--R--T--T--E--Q--H--V--P--E-
121    GGTGGAAGTCCAAGTCAAACGCAGAAGGACTGCCTCACTGAGCAACCAAGAGTGTCAGTT    180
       -V--E--V--Q--V--K--R--R--R--T--A--S--L--S--N--Q--E--C--Q--L-
181    GTACCCGAGGCGTTCTCAGCAGCAGCAAGTACCTGTGGTGGATTTCCAGGCTGAACTGAG    240
       -Y--P--R--R--S--Q--Q--Q--Q--V--P--V--V--D--F--Q--A--E--L--R-
241    GCAGGCATTCTTAGCTGAGACACCAAGAGGTGGTTAAagccatattggagtagcgaggaa    300
       -Q--A--F--L--A--E--T--P--R--G--G--***.......................
301    tctgattccaagcaaaaaccaggctccatctactctttgaagcttctgcccagcttgcat    360
       ............................................................
361    tgtttctaggagaacctgcgtcatacctttatctatagccttcccctaggtcttcagaag    420
       ............................................................
421    catcaagttttaactgtggacattggatttggtggaacagcaatcatgactgttggcaag    480
       ............................................................
481    agtagcaagatgctgcagcacattgactatagaatgagatgtatcctgcaagatggccga    540
       ............................................................
541    atcttcattggcacctttaaggcttttgacaagcatatgaatttgatcctctgtgattgt    600
       ............................................................
601    gatgagttcagaaagatcaagccaaagaatgcgaagcaaccagagcgtgaagaaaagcgg    660
       ............................................................
661    gttttgggtctggtgttgctgcgtggggagaacttggtatccatgactgtggaggggcca    720
       ............................................................
721    ccccccaaagatactggcattgctcgggtaccacttgctggagctgctggaggccctggg    780
       ............................................................
781    gttggtagggcagctggtagaggagtaccagctggtgtgccaattccccaggcccctgct    840
       ............................................................
841    ggattggcaggccctgtccgaggagttgggggaccatcccagcaggtaatgactccacag    900
       ............................................................
901    ggaagaggcactgtagcagctgctgctgttgctgcgactgccagtattgctggagcccca    960
       ............................................................
961    acacagtacccaccaggacggggcactccgcccccacccgtcggcagagcaaccccacct   1020
       ............................................................
1021   ccaggcattatggctcctccacctggtatgagaccacccatgggcccaccaattgggctt   1080
       ............................................................
1081   ccccctgctcgagggacgccaataggcatgccgcctccgggaatgagaccccctccacca   1140
       ............................................................
1141   ggcattagaggtccacctcccccaggaatgcgtccaccaagaccttagcatactgttgat   1200
       ............................................................
1201   ccatctcagtcactttttcccctgcaatgcgtcttgtgaaattgtgtagagtgtttgtga   1260
       ............................................................
1261   gctttttgttccctcattctgcattaataatagctaataataaatgcatagagcaattaa   1320
       ............................................................
1321   actgtg                                                         1380
       ......