Imprinted Gene Databases

Homo sapiens: SNRPN

Small nuclear ribonucleoprotein polypeptide N
Species Gene Aliases Location Status Expressed Allele
Homo sapiens SNRPN SMN, PWCR, SM-D, RT-LI, HCERN3, SNRNP-N, FLJ33569, FLJ36996, FLJ39265, MGC29886, SNURF-SNRPN, DKFZp762N022, DKFZp686C0927, DKFZp761I1912, DKFZp686M12165  15q11.2  Imprinted Paternal
Bos taurus SNRPN   21  Imprinted Paternal
Macaca mulatta SNRPN   Imprinted Paternal
Mus musculus Snurf Snrpn, MGC18604, MGC30325, 2410045I01Rik  7 B5  Imprinted Paternal
Mus musculus Snrpn SMN, Peg4, HCERN3, MGC18604, MGC30325, 2410045I01Rik  7 29.0 cM  Imprinted Paternal
1      cagagtggagcggccgccggagatgcctgacgcatctgtctgaggagcggtcagtgacgc     60
       ............................................................
61     gatggagcgggcaagggatcgcttacacctgagacgaactacagaacagcacgtaccaga    120
       ............................................................
121    ggtggaagtccaagtcaaacgcagaaggactgcctcactgagcaaccaagagtgtcagtt    180
       ............................................................
181    gtacccgaggcgttctcagcagcagcaagtacctgtggtggatttccaggctgaactgag    240
       ............................................................
241    gcaggcattcttagctgagacaccaagaggtggttaaagccatattggagtagcgaggaa    300
       ............................................................
301    tctgattccaagcaaaaaccaggctccatctactctttgaagcttctgcccagcttgcat    360
       ............................................................
361    tgtttctaggagaacctgcgtcatacctttatctatagccttcccctaggtcttcagaag    420
       ............................................................
421    catcaagttttaactgtggacattggatttggtggaacagcaatcATGACTGTTGGCAAG    480
       .............................................M--T--V--G--K--
481    AGTAGCAAGATGCTGCAGCACATTGACTATAGAATGAGATGTATCCTGCAAGATGGCCGA    540
       S--S--K--M--L--Q--H--I--D--Y--R--M--R--C--I--L--Q--D--G--R--
541    ATCTTCATTGGCACCTTTAAGGCTTTTGACAAGCATATGAATTTGATCCTCTGTGATTGT    600
       I--F--I--G--T--F--K--A--F--D--K--H--M--N--L--I--L--C--D--C--
601    GATGAGTTCAGAAAGATCAAGCCAAAGAATGCGAAGCAACCAGAGCGTGAAGAAAAGCGG    660
       D--E--F--R--K--I--K--P--K--N--A--K--Q--P--E--R--E--E--K--R--
661    GTTTTGGGTCTGGTGTTGCTGCGTGGGGAGAACTTGGTATCCATGACTGTGGAGGGGCCA    720
       V--L--G--L--V--L--L--R--G--E--N--L--V--S--M--T--V--E--G--P--
721    CCCCCCAAAGATACTGGCATTGCTCGGGTACCACTTGCTGGAGCTGCTGGAGGCCCTGGG    780
       P--P--K--D--T--G--I--A--R--V--P--L--A--G--A--A--G--G--P--G--
781    GTTGGTAGGGCAGCTGGTAGAGGAGTACCAGCTGGTGTGCCAATTCCCCAGGCCCCTGCT    840
       V--G--R--A--A--G--R--G--V--P--A--G--V--P--I--P--Q--A--P--A--
841    GGATTGGCAGGCCCTGTCCGAGGAGTTGGGGGACCATCCCAGCAGGTAATGACTCCACAG    900
       G--L--A--G--P--V--R--G--V--G--G--P--S--Q--Q--V--M--T--P--Q--
901    GGAAGAGGCACTGTAGCAGCTGCTGCTGTTGCTGCGACTGCCAGTATTGCTGGAGCCCCA    960
       G--R--G--T--V--A--A--A--A--V--A--A--T--A--S--I--A--G--A--P--
961    ACACAGTACCCACCAGGACGGGGCACTCCGCCCCCACCCGTCGGCAGAGCAACCCCACCT   1020
       T--Q--Y--P--P--G--R--G--T--P--P--P--P--V--G--R--A--T--P--P--
1021   CCAGGCATTATGGCTCCTCCACCTGGTATGAGACCACCCATGGGCCCACCAATTGGGCTT   1080
       P--G--I--M--A--P--P--P--G--M--R--P--P--M--G--P--P--I--G--L--
1081   CCCCCTGCTCGAGGGACGCCAATAGGCATGCCGCCTCCGGGAATGAGACCCCCTCCACCA   1140
       P--P--A--R--G--T--P--I--G--M--P--P--P--G--M--R--P--P--P--P--
1141   GGCATTAGAGGTCCACCTCCCCCAGGAATGCGTCCACCAAGACCTTAGcatactgttgat   1200
       G--I--R--G--P--P--P--P--G--M--R--P--P--R--P--***............
1201   ccatctcagtcactttttcccctgcaatgcgtcttgtgaaattgtgtagagtgtttgtga   1260
       ............................................................
1261   gctttttgttccctcattctgcattaataatagctaataataaatgcatagagcaattaa   1320
       ............................................................
1321   actgtg                                                         1380
       ......