Imprinted Gene Databases

Homo sapiens: SGCE

Sarcoglycan, epsilon
Species Gene Aliases Location Status Expressed Allele
Mus musculus Sgce e-SG  6 1.0 cM  Imprinted Paternal
Homo sapiens SGCE ESG, DYT11  7q21-q22  Imprinted Paternal
Sus scrofa SGCE   Imprinted Paternal
1      cgggattaccgagggggtgcgggatgctgatgctgaactggccaagctgggagggaagaa     60
       ............................................................
61     gaaagggaggggaggggagaatcgaggacggacggcctagccaggccaagaATGCAATTG    120
       ...................................................M--Q--L--
121    CCCCGGTGGTGGGAGCTGGGAGACCCCTGTGCTTGGACGGGACAGGGTCGGGGGACACGC    180
       P--R--W--W--E--L--G--D--P--C--A--W--T--G--Q--G--R--G--T--R--
181    AGGATGAGCCCCGCGACCACTGGCACATTCTTGCTGACAGTGTACAGTATTTTCTCCAAG    240
       R--M--S--P--A--T--T--G--T--F--L--L--T--V--Y--S--I--F--S--K--
241    GTACACTCCGATCGGAATGTATACCCATCAGCAGGTGTCCTCTTTGTTCATGTTTTGGAA    300
       V--H--S--D--R--N--V--Y--P--S--A--G--V--L--F--V--H--V--L--E--
301    AGAGAATATTTTAAGGGGGAATTTCCACCTTACCCAAAACCTGGCGAGATTAGTAATGAT    360
       R--E--Y--F--K--G--E--F--P--P--Y--P--K--P--G--E--I--S--N--D--
361    CCCATAACATTTAATACAAATTTAATGGGTTACCCAGACCGACCTGGATGGCTTCGATAT    420
       P--I--T--F--N--T--N--L--M--G--Y--P--D--R--P--G--W--L--R--Y--
421    ATCCAAAGGACACCATATAGTGATGGAGTCCTATATGGGTCCCCAACAGCTGAAAATGTG    480
       I--Q--R--T--P--Y--S--D--G--V--L--Y--G--S--P--T--A--E--N--V--
481    GGGAAGCCAACAATCATTGAGATAACTGCCTACAACAGGCGCACCTTTGAGACTGCAAGG    540
       G--K--P--T--I--I--E--I--T--A--Y--N--R--R--T--F--E--T--A--R--
541    CATAATTTGATAATTAATATAATGTCTGCAGAAGACTTCCCGTTGCCATATCAAGCAGAA    600
       H--N--L--I--I--N--I--M--S--A--E--D--F--P--L--P--Y--Q--A--E--
601    TTCTTCATTAAGAATATGAATGTAGAAGAAATGTTGGCCAGTGAGGTTCTTGGAGACTTT    660
       F--F--I--K--N--M--N--V--E--E--M--L--A--S--E--V--L--G--D--F--
661    CTTGGCGCAGTGAAAAATGTGTGGCAGCCAGAGCGCCTGAACGCCATAAACATCACATCG    720
       L--G--A--V--K--N--V--W--Q--P--E--R--L--N--A--I--N--I--T--S--
721    GCCCTAGACAGGGGTGGCAGGGTGCCACTTCCCATTAATGACCTGAAGGAGGGCGTTTAT    780
       A--L--D--R--G--G--R--V--P--L--P--I--N--D--L--K--E--G--V--Y--
781    GTCATGGTTGGTGCAGATGTCCCGTTTTCTTCTTGTTTACGAGAAGTTGAAAATCCACAG    840
       V--M--V--G--A--D--V--P--F--S--S--C--L--R--E--V--E--N--P--Q--
841    AATCAATTGAGATGTAGTCAAGAAATGGAGCCTGTAATAACATGTGATAAAAAATTTCGT    900
       N--Q--L--R--C--S--Q--E--M--E--P--V--I--T--C--D--K--K--F--R--
901    ACTCAATTTTACATTGACTGGTGCAAAATTTCATTGGTTGATAAAACAAAGCAAGTGTCC    960
       T--Q--F--Y--I--D--W--C--K--I--S--L--V--D--K--T--K--Q--V--S--
961    ACCTATCAGGAAGTGATTCGTGGAGAGGGGATTTTACCTGATGGTGGAGAATACAAACCC   1020
       T--Y--Q--E--V--I--R--G--E--G--I--L--P--D--G--G--E--Y--K--P--
1021   CCTTCTGATTCTTTGAAAAGCAGAGACTATTACACGGATTTCCTAATTACACTGGCTGTG   1080
       P--S--D--S--L--K--S--R--D--Y--Y--T--D--F--L--I--T--L--A--V--
1081   CCCTCGGCAGTGGCACTGGTCCTTTTTCTAATACTTGCTTATATCATGTGCTGCCGACGG   1140
       P--S--A--V--A--L--V--L--F--L--I--L--A--Y--I--M--C--C--R--R--
1141   GAAGGCGTGGAAAAGAGAAACATGCAAACACCAGACATCCAACTGGTCCATCACAGTGCT   1200
       E--G--V--E--K--R--N--M--Q--T--P--D--I--Q--L--V--H--H--S--A--
1201   ATTCAGAAATCTACCAAGGAGCTTCGAGACATGTCCAAGAATAGAGAGATAGCATGGCCC   1260
       I--Q--K--S--T--K--E--L--R--D--M--S--K--N--R--E--I--A--W--P--
1261   CTGTCAACGCTTCCTGTGTTCCACCCTGTGACTGGGGAAATCATACCTCCTTTACACACA   1320
       L--S--T--L--P--V--F--H--P--V--T--G--E--I--I--P--P--L--H--T--
1321   GACAACTATGATAGCACAAACATGCCATTGATGCAAACGCAGCAGAACTTGCCACATCAG   1380
       D--N--Y--D--S--T--N--M--P--L--M--Q--T--Q--Q--N--L--P--H--Q--
1381   ACTCAGATTCCCCAACAGCAGACTACAGGTAAATGGTATCCCTGAagaaagaaaactgac   1440
       T--Q--I--P--Q--Q--Q--T--T--G--K--W--Y--P--***...............
1441   tgaagcaatgaatttataatcagacaatatagcagttacatcacatttcttttctcttcc   1500
       ............................................................
1501   aataatgcatgagcttttctggcatatgttatgcatgttggcagtattaagtgtatacca   1560
       ............................................................
1561   aataatacaacataactttcattttactaatgtatttttttgtacttaaagcatttttga   1620
       ............................................................
1621   caatttgtaaaacattgatgactttatatttgttacaataaaagttgatctttaaaataa   1680
       ............................................................
1681   atattattaatgaagcctaaaaaaaaaaa                                  1740
       .............................