Imprinted Gene Databases

Homo sapiens: SGCE

Sarcoglycan, epsilon
Species Gene Aliases Location Status Expressed Allele
Homo sapiens SGCE ESG, DYT11  7q21-q22  Imprinted Paternal
Sus scrofa SGCE   Imprinted Paternal
Mus musculus Sgce e-SG  6 1.0 cM  Imprinted Paternal
1      cgggattaccgagggggtgcgggatgctgatgctgaactggccaagctgggagggaagaa     60
61     gaaagggaggggaggggagaatcgaggacggacggcctagccaggccaagaATGCAATTG    120
1441   tgaagcaatgaatttataatcagacaatatagcagttacatcacatttcttttctcttcc   1500
1501   aataatgcatgagcttttctggcatatgttatgcatgttggcagtattaagtgtatacca   1560
1561   aataatacaacataactttcattttactaatgtatttttttgtacttaaagcatttttga   1620
1621   caatttgtaaaacattgatgactttatatttgttacaataaaagttgatctttaaaataa   1680
1681   atattattaatgaagcctaaaaaaaaaaa                                  1740