Imprinted Gene Databases

Homo sapiens: SFMBT2

Scm-like with four mbt domains 2

Wang et al., BMC Genomics 12: 204, 2011

Species Gene Aliases Location Status Expressed Allele
Homo sapiens SFMBT2   10p14  Not Imprinted Biallelic
Rattus norvegicus Sfmbt2   17q12.3  Imprinted Maternal
Mus musculus Sfmbt2 D2Wsu23e, D330030P06Rik  2 6.0 cM  Imprinted Paternal
Bos taurus SFMBT2   13  Not Imprinted Biallelic
1      aaagcgcaagtttgtgcacacggtcgactgagccattggaaacccagctcacgaaccgca     60
       ............................................................
61     gccagggaaacgggagtttgcccagttgtccttgcggaggggtgtgcggaaacgcccgcg    120
       ............................................................
121    atgggaactttctgcagatcatgtaattttttctgcaggatgaattaagagaagagacac    180
       ............................................................
181    ttgctcatcaggcATGGAGAGCACTTTGTCAGCTTCCAATATGCAAGACCCTTCATCTTC    240
       .............M--E--S--T--L--S--A--S--N--M--Q--D--P--S--S--S-
241    ACCCTTGGAAAAGTGTCTCGGCTCAGCTAATGGAAATGGAGACCTTGATTCTGAAGAAGG    300
       -P--L--E--K--C--L--G--S--A--N--G--N--G--D--L--D--S--E--E--G-
301    CTCAAGCTTGGAGGAAACTGGCTTTAACTGGGGAGAATATTTGGAAGAGACAGGAGCAAG    360
       -S--S--L--E--E--T--G--F--N--W--G--E--Y--L--E--E--T--G--A--S-
361    TGCTGCTCCCCACACATCATTCAAACACGTTGAAATCAGCATTCAGAGCAACTTCCAGCC    420
       -A--A--P--H--T--S--F--K--H--V--E--I--S--I--Q--S--N--F--Q--P-
421    AGGAATGAAATTGGAAGTGGCTAATAAGAACAACCCGGACACGTACTGGGTGGCCACGAT    480
       -G--M--K--L--E--V--A--N--K--N--N--P--D--T--Y--W--V--A--T--I-
481    CATTACCACGTGCGGGCAGCTGCTGCTTCTGCGCTACTGCGGTTACGGGGAGGACCGCAG    540
       -I--T--T--C--G--Q--L--L--L--L--R--Y--C--G--Y--G--E--D--R--R-
541    GGCCGACTTCTGGTGTGACGTAGTCATCGCGGATTTGCACCCCGTGGGGTGGTGCACACA    600
       -A--D--F--W--C--D--V--V--I--A--D--L--H--P--V--G--W--C--T--Q-
601    GAACAACAAGGTGTTGATGCCGCCGGACGCAATCAAAGAGAAGTACACAGACTGGACAGA    660
       -N--N--K--V--L--M--P--P--D--A--I--K--E--K--Y--T--D--W--T--E-
661    ATTTCTCATACGTGACTTGACTGGTTCGAGGACAGCACCCGCCAACCTCCTGGAAGGTCC    720
       -F--L--I--R--D--L--T--G--S--R--T--A--P--A--N--L--L--E--G--P-
721    TCTGCGAGGGAAAGGCCCTATAGACCTCATTACAGTTGGTTCCTTAATAGAACTTCAGGA    780
       -L--R--G--K--G--P--I--D--L--I--T--V--G--S--L--I--E--L--Q--D-
781    TTCCCAGAACCCTTTTCAGTACTGGATAGTTAGTGTGATTGAAAATGTTGGAGGAAGATT    840
       -S--Q--N--P--F--Q--Y--W--I--V--S--V--I--E--N--V--G--G--R--L-
841    ACGCCTTCGCTATGTGGGATTGGAGGACACTGAATCCTATGACCAGTGGTTGTTTTACTT    900
       -R--L--R--Y--V--G--L--E--D--T--E--S--Y--D--Q--W--L--F--Y--L-
901    GGATTACAGACTTCGACCAGTTGGTTGGTGTCAAGAGAATAAATACAGAATGGACCCACC    960
       -D--Y--R--L--R--P--V--G--W--C--Q--E--N--K--Y--R--M--D--P--P-
961    TTCAGAAATCTATCCTTTGAAGATGGCCTCTGAATGGAAATGTACTCTGGAAAAATCCCT   1020
       -S--E--I--Y--P--L--K--M--A--S--E--W--K--C--T--L--E--K--S--L-
1021   TATTGATGCTGCCAAATTTCCTCTTCCAATGGAAGTGTTTAAGGATCACGCAGATTTGCG   1080
       -I--D--A--A--K--F--P--L--P--M--E--V--F--K--D--H--A--D--L--R-
1081   AAGCCATTTCTTCACAGTTGGGATGAAGCTTGAGACAGTGAATATGTGCGAGCCCTTTTA   1140
       -S--H--F--F--T--V--G--M--K--L--E--T--V--N--M--C--E--P--F--Y-
1141   CATCTCTCCTGCGTCGGTGACTAAGGTTTTTAACAATCACTTTTTTCAAGTGACTATTGA   1200
       -I--S--P--A--S--V--T--K--V--F--N--N--H--F--F--Q--V--T--I--D-
1201   TGACCTAAGACCTGAACCAAGTAAACTGTCAATGCTGTGCCATGCAGATTCTTTGGGGAT   1260
       -D--L--R--P--E--P--S--K--L--S--M--L--C--H--A--D--S--L--G--I-
1261   TTTGCCAGTACAGTGGTGCCTTAAAAATGGAGTCAGCCTCACTCCTCCCAAAGGTTACTC   1320
       -L--P--V--Q--W--C--L--K--N--G--V--S--L--T--P--P--K--G--Y--S-
1321   TGGCCAGGACTTCGACTGGGCAGATTATCACAAGCAGCATGGGGCGCAGGAAGCCCCTCC   1380
       -G--Q--D--F--D--W--A--D--Y--H--K--Q--H--G--A--Q--E--A--P--P-
1381   CTTCTGCTTCCGAAATACATCATTCAGTCGAGGTTTCACAAAGAACATGAAACTTGAAGC   1440
       -F--C--F--R--N--T--S--F--S--R--G--F--T--K--N--M--K--L--E--A-
1441   TGTGAACCCCAGGAATCCAGGAGAACTGTGTGTGGCCTCCGTTGTGAGTGTGAAGGGGCG   1500
       -V--N--P--R--N--P--G--E--L--C--V--A--S--V--V--S--V--K--G--R-
1501   GCTAATGTGGCTTCACCTGGAAGGGCTGCAGACTCCTGTTCCAGAGGTCATTGTTGATGT   1560
       -L--M--W--L--H--L--E--G--L--Q--T--P--V--P--E--V--I--V--D--V-
1561   GGAATCCATGGACATCTTCCCAGTGGGCTGGTGTGAAGCCAATTCTTATCCTTTGACTGC   1620
       -E--S--M--D--I--F--P--V--G--W--C--E--A--N--S--Y--P--L--T--A-
1621   ACCACACAAAACAGTCTCACAAAAGAAGAGAAAGATTGCAGTCGTGCAACCAGAGAAACA   1680
       -P--H--K--T--V--S--Q--K--K--R--K--I--A--V--V--Q--P--E--K--Q-
1681   ATTGCCGCCCACAGTGCCTGTTAAGAAAATACCTCATGACCTTTGTTTATTCCCTCACCT   1740
       -L--P--P--T--V--P--V--K--K--I--P--H--D--L--C--L--F--P--H--L-
1741   GGACACCACAGGAACCGTCAACGGGAAATACTGCTGTCCTCAGCTCTTCATCAACCACAG   1800
       -D--T--T--G--T--V--N--G--K--Y--C--C--P--Q--L--F--I--N--H--R-
1801   GTGTTTCTCAGGCCCTTACCTGAACAAAGGAAGGATTGCAGAGCTACCTCAGTCGGTGGG   1860
       -C--F--S--G--P--Y--L--N--K--G--R--I--A--E--L--P--Q--S--V--G-
1861   ACCGGGCAAATGCGTGCTGGTTCTTAAAGAGGTTCTTAGCATGATAATCAACGCAGCCTA   1920
       -P--G--K--C--V--L--V--L--K--E--V--L--S--M--I--I--N--A--A--Y-
1921   CAAGCCTGGAAGGGTATTAAGAGAATTACAGCTGGTAGAAGATCCCCACTGGAATTTCCA   1980
       -K--P--G--R--V--L--R--E--L--Q--L--V--E--D--P--H--W--N--F--Q-
1981   GGAAGAGACGCTGAAGGCCAAATACAGAGGCAAAACATACAGGGCTGTGGTCAAAATCGT   2040
       -E--E--T--L--K--A--K--Y--R--G--K--T--Y--R--A--V--V--K--I--V-
2041   ACGGACATCTGACCAAGTCGCAAATTTCTGCCGCCGAGTCTGTGCCAAGCTAGAGTGCTG   2100
       -R--T--S--D--Q--V--A--N--F--C--R--R--V--C--A--K--L--E--C--C-
2101   TCCAAATTTGTTTAGTCCTGTGCTGATATCTGAAAACTGCCCAGAGAACTGCTCCATTCA   2160
       -P--N--L--F--S--P--V--L--I--S--E--N--C--P--E--N--C--S--I--H-
2161   TACCAAAACCAAATACACCTATTACTATGGAAAGAGAAAGAAGATCTCCAAGCCCCCCAT   2220
       -T--K--T--K--Y--T--Y--Y--Y--G--K--R--K--K--I--S--K--P--P--I-
2221   CGGGGAAAGCAACCCCGACAGCGGACACCCCAAACCCGCCAGGCGGAGGAAGCGACGGAA   2280
       -G--E--S--N--P--D--S--G--H--P--K--P--A--R--R--R--K--R--R--K-
2281   ATCCATTTTCGTGCAGAAGAAACGGAGGTCTTCTGCCGTGGACTTCACCGCGGGCTCGGG   2340
       -S--I--F--V--Q--K--K--R--R--S--S--A--V--D--F--T--A--G--S--G-
2341   GGAGGAAAGTGAAGAGGAGGACGCTGACGCCATGGACGATGACACCGCCAGTGAGGAGAC   2400
       -E--E--S--E--E--E--D--A--D--A--M--D--D--D--T--A--S--E--E--T-
2401   CGGCTCCGAGCTCCGGGATGACCAGACGGACACCTCGTCGGCGGAGGTGCCCTCGGCCCG   2460
       -G--S--E--L--R--D--D--Q--T--D--T--S--S--A--E--V--P--S--A--R-
2461   GCCCCGGAGGGCCGTCACCCTGCGGAGCGGCTCAGAGCCCGTGCGCCGGCCACCCCCAGA   2520
       -P--R--R--A--V--T--L--R--S--G--S--E--P--V--R--R--P--P--P--E-
2521   GAGGACACGAAGGGGCCGCGGGGCGCCGGCTGCCTCCTCAGCAGAGGAAGGGGAGAAGTG   2580
       -R--T--R--R--G--R--G--A--P--A--A--S--S--A--E--E--G--E--K--C-
2581   CCCGCCGACCAAGCCCGAGGGGACAGAGGACACGAAACAGGAGGAGGAGGAGAGACTGGT   2640
       -P--P--T--K--P--E--G--T--E--D--T--K--Q--E--E--E--E--R--L--V-
2641   TCTGGAGAGCAACCCGTTGGAGTGGACGGTCACCGACGTGGTGAGGTTCATTAAGCTGAC   2700
       -L--E--S--N--P--L--E--W--T--V--T--D--V--V--R--F--I--K--L--T-
2701   AGACTGTGCCCCCTTGGCCAAGATATTTCAGGAGCAGGATATTGACGGCCAAGCACTCCT   2760
       -D--C--A--P--L--A--K--I--F--Q--E--Q--D--I--D--G--Q--A--L--L-
2761   GCTTCTGACCCTTCCGACGGTGCAGGAGTGCATGGAGCTGAAGCTGGGGCCTGCCATCAA   2820
       -L--L--T--L--P--T--V--Q--E--C--M--E--L--K--L--G--P--A--I--K-
2821   GTTATGCCACCAGATCGAGAGAGTCAAAGTGGCTTTCTACGCCCAGTACGCCAACTGAgt   2880
       -L--C--H--Q--I--E--R--V--K--V--A--F--Y--A--Q--Y--A--N--***..
2881   ctgccctcgggaggtggcccattattgctgggatgcggtgttggtaaaggtttccaggac   2940
       ............................................................
2941   tgaaactttgattttccgggatatgttaaatggtacagccactaagtatcaccagaaaac   3000
       ............................................................
3001   cagaagcccaggatcttctgcctccgccagcctgtgagctgtttccatgttttcaaagca   3060
       ............................................................
3061   cagcagcagtcgcttctggggagtgccagttaaagtcatgcatcagaccctgccagacgt   3120
       ............................................................
3121   gggcctgcttcttggctcacccacgttttgcctttctcctgccccaaatcaggcagctcc   3180
       ............................................................
3181   cttggagcagggtttcctcagatgaggactgcattctttgaaaacaaagaatgtcgccaa   3240
       ............................................................
3241   ggaagaaacctcacgccatgctgtagtgtttcctgtaatcacacgagcacatttatatat   3300
       ............................................................
3301   gcagtttcccatggataggcgtgtgaccctggttgagtggcacttgcggtttcatcttgg   3360
       ............................................................
3361   tggcaactcctttgcaatgcagctggcagcgacatccttataaaaacatgtgctaaagct   3420
       ............................................................
3421   ctgtcctctgttagaggtgccttttaggaatacggggagtgaaggaaggccggcaggcat   3480
       ............................................................
3481   ctccatgcaactagatggtttgtttgtttgtttgtttgtttgttgttcattttgttgtgt   3540
       ............................................................
3541   tttttgagacagggtcttgctctgtcgcccaggttgtaatgcagtggcgcaatctcagct   3600
       ............................................................
3601   cactgcaacctctctctcccgggttcaagtgattctcctgcctcagcctcccaagtagct   3660
       ............................................................
3661   gggattacaggcacccaccaccatgcctggctaatttttgtatttttggtagagacaggg   3720
       ............................................................
3721   tttcaccatgttggtcaggctagtcttgaactcccaacctcaagtgatctgcccgcctcg   3780
       ............................................................
3781   gcctcccaacgtgctgggattacaggtgtgagccactacgccccggcccaactggatggt   3840
       ............................................................
3841   ttttgattgaagcctagaacatctgtagagacaaactctacccagtcttttctagaccct   3900
       ............................................................
3901   caactatctccagtgttgttgtttaatcgtagccggatcagggagtgagtcttttaggca   3960
       ............................................................
3961   aatgttggattatatatcaaaggaaaagcttagtttcagagaggaggaagggaaagagat   4020
       ............................................................
4021   gtgagggaagcatttcatcaaccagctacgtcccccttagaaggatcactgcagcaggtc   4080
       ............................................................
4081   accgagcaggagtccctctgagcgtcccttctgtctcgttctgccctagctggcagcata   4140
       ............................................................
4141   tgaaccaggcatgatgcagcaggagcagtgaatctggagtcagccacttggcaccctggt   4200
       ............................................................
4201   ttcgctgagaacaaactctgagatcttgggtgacttctcatcactctggacctccattcc   4260
       ............................................................
4261   tgtgaagtgacaggtgtggaccctgagggtgcggtggtgagcacactgtctcctgctggc   4320
       ............................................................
4321   attcaccccactcatgctggaaaggaagatccagatcgtacaaaaattagaaaaagaaag   4380
       ............................................................
4381   aataagaagggtctggtcccagttctgactcggccattcttacagctctttctggctttg   4440
       ............................................................
4441   agtttgcttgtggaatttcctgggcagttgtgttaaatccgccaggtcacgtgcagacaa   4500
       ............................................................
4501   agctgtggctgcgagagttggctggcctcttggaccagaagccatctccatatcctcatg   4560
       ............................................................
4561   agcgattccatatctccactcagaccctgtggactacagtgttccgctgtggtggctgcc   4620
       ............................................................
4621   aagatgccttcttaaacttatgcaaggaaaccaaaccctcccacagttcccaagcagaca   4680
       ............................................................
4681   ctggaagcagaggcttctcacccttcctgctttttcaccacaatcaccttgagctcgtcc   4740
       ............................................................
4741   cttggactagagtctccacagttccagtaaaattctgcggtgggctgatgagctgcttgc   4800
       ............................................................
4801   atttctgtgacatttccagatatgattctcagtgggattttggaaactttgattgctcaa   4860
       ............................................................
4861   gctcacccttcttaacattctgtaatggttacagatgagaatggaaaacacatattttat   4920
       ............................................................
4921   ggatgaggcgttttggtctcccctgcagtcgatttctagaatcaagttttagagttcggc   4980
       ............................................................
4981   tgatgcatctgcctggggacctcagatgggaggagtgtgtcagttgtaccccgacagaaa   5040
       ............................................................
5041   tgtctctgggatctgtggctggcttgccccgggcatctctcctttaagctcaagttttga   5100
       ............................................................
5101   actctctgcggttttccacccctgccttctcagccacatgcttttggccttaaacgctca   5160
       ............................................................
5161   gtcttgtggagttcaactctgtcaaacgattggaaagggcatccatttccagatctttgg   5220
       ............................................................
5221   cattttccccgcgctgactctttgatgatccttcactgtggccttttcaagctcagctgt   5280
       ............................................................
5281   tcctgttgtatttgagacgagggtgagggaatgtggtggccacaaaagaacagggacttg   5340
       ............................................................
5341   cagcacaaatgtcacttctgtctcccttttcagtggtagcacggaggaggaggtgctgcg   5400
       ............................................................
5401   ttggagggaggggatcctccaggagctctctggagcccatctaggaagctagagtgtgtg   5460
       ............................................................
5461   gcccgccaggagctcaggaaggatacagccactgtcgcaggggaaagtgtttgcttcccg   5520
       ............................................................
5521   tggagccaagcgcccaagactctccgtatccttcaccctgacagtttaacttcagcgttt   5580
       ............................................................
5581   ctctgtgcagttgcggtcaccatgggtgagcactgtctgtgcacgtgccagggaggagat   5640
       ............................................................
5641   ggctgggaccactgcacaggagggcgcagcctggcgtcgccatgaaagttgtctctgtgc   5700
       ............................................................
5701   catctctccggtccttgaggagagcccagaaagattttaggacccaggaggtgcttttcc   5760
       ............................................................
5761   tccagctgttgccagtgtccttctgagcctggattctccggggatttccgtcgtggtgga   5820
       ............................................................
5821   tggacttcacatcagcagcagttctggtacagaattgtaatgtgttttcatttctctgta   5880
       ............................................................
5881   ggattcacctctcaccagcgtctgtcttaaaggtagggccaatttcatggagcatttttc   5940
       ............................................................
5941   tgtgtgtgtccttgttgcttttgccagaaaaagtggatttgacatgcgtgccccgatgcc   6000
       ............................................................
6001   accatagcccctaggccaacaatgtcatggtctaaacaccaaaaagtgatgccccgcatt   6060
       ............................................................
6061   ccttccctggatggtaccgtttcttctccgtctctctttgatgattctttgggaccaaag   6120
       ............................................................
6121   tcctctccttagtgcgcctacttcctgtgggcatcatgccacttggaacttattggaact   6180
       ............................................................
6181   ggcccgggagactctgcagtctgcgccgtttgaaaaccctgagaaagagatgccacctca   6240
       ............................................................
6241   acttgaatcatgacagcccatcgctcagtctcaccctaaactcatggagcttgtttcagc   6300
       ............................................................
6301   tcctcacttcttgactgtatttgtactatgttgaaaaaatatcctgtccacaaagacata   6360
       ............................................................
6361   agcctaacaacctagaaaaacaacagggtactactggcattacagaacttctttgccttt   6420
       ............................................................
6421   caaaacaaaagcaaaacacagtgaacttcaccacggagctgcacagcgtggggaactcat   6480
       ............................................................
6481   ccatcactttcaaaattagagtcatttgatccaagttggagtcagacacagtatttgagc   6540
       ............................................................
6541   tgcacggcttctgggttctcccaccttatttgatcatattcgaaagattatttcctgtgt   6600
       ............................................................
6601   ttgctttgatttgttcctcagtacattaaaatgatccacaccttgaacactgccctctct   6660
       ............................................................
6661   agaaggttgattttgatcagccttttgaagatgggtgtcgtttccctaacttatctcaca   6720
       ............................................................
6721   gaattttgagtgttgtatttggcaagttctgagatttgccttctgtcttatgccaaacac   6780
       ............................................................
6781   ccctttctaagagctgtccccgcttagttttagaagtactaggggttttcatacttattt   6840
       ............................................................
6841   tatagaacacccatttatatttatttctgtatatagaactaaaaaaaacagtagtgttaa   6900
       ............................................................
6901   aaatctttgttgtggtttgagcatctttgctgcttttggattgagatggcgaatcaaggc   6960
       ............................................................
6961   ttcacttcctctctcttctgtctttagaaagctgtgatcgtgcgtgcaattatttgaaag   7020
       ............................................................
7021   gcaacatagtcaattaagaaacctgtagttgttaaggaagaaattgttggcaagatatcc   7080
       ............................................................
7081   atactgcccatatctcgttggtgcaataattaaatagcaaaggaaatctgtattggcaac   7140
       ............................................................
7141   tattataattcaataattcttttgtttactgcccttttctgttcaagaattttctggaaa   7200
       ............................................................
7201   ttactccctttcacatggttgaactcttaagttgaccagttctcatagctctatcactag   7260
       ............................................................
7261   aatggtttgcagataccccaaacatactatgataaaatcaaattgtgctacttttgaccc   7320
       ............................................................
7321   atgtaatttacctaaaagttgtaattgctgacagagtactgccttgaattttggtttaaa   7380
       ............................................................
7381   acctctctagtttcaatgacaagtaacaactcaaataattccatattgtttgaggaagag   7440
       ............................................................
7441   gccataatccttctgaattgttggcactaagtaatgggatttggcccagtaagtatgacg   7500
       ............................................................
7501   gtcgtgtcgcctaaccaacgcagagcagtgctttttgtgtggctgaagcgatgtgctgac   7560
       ............................................................
7561   gaaaaaaggaaaattctaggacaatcgttggctaaaaatcaccttaggatgaaaaatttg   7620
       ............................................................
7621   aggcaaatttttttaaatgacagaaaaagataatcatctcacttgcttgaaacaggagcc   7680
       ............................................................
7681   agcatgatctctggaagcatcaactatccctcgtcgtgattgttgaaagctctttcactg   7740
       ............................................................
7741   ttttgcattctagtttgaatagtttgtattgaaattggattcctatcttgtgtatgtttt   7800
       ............................................................
7801   tggtgcgtaaaagggaaaaattggtgtcattacttttgaaatttgcaggacgaagggcat   7860
       ............................................................
7861   gcttttggtttgctgtaagattgtattctgtatatatgttttcatgtaaataaatgaaaa   7920
       ............................................................
7921   tctatatcagagttatattttaatttttattctaaatgaaaaaaaccctttttacttcaa   7980
       ............................................................
7981   aaaaattgtaagccacattgttaataaagtaaaaataaattcta                   8040
       ............................................