Imprinted Gene Databases

Homo sapiens: RASGRF1

Ras protein-specific guanine nucleotide-releasing factor 1
Species Gene Aliases Location Status Expressed Allele
Homo sapiens RASGRF1 GNRP, GRF1, CDC25, GRF55, CDC25L, H-GRF55, PP13187  15q24.2  Unknown Unknown
Rattus norvegicus Rasgrf1   8q31  Imprinted Paternal
Sus scrofa RASGRF1 CDC25, CDC25L, GNRP, GRF1, GRF55, H-GRF55, PP13187  7 53.66  Imprinted Tissue Dependent
Mus musculus Rasgrf1 Grf1, p190, CDC25, P190-A, CDC25Mm, Grfbeta, Ras-GRF1, p190RhoGEF  9 50.0 cM  Imprinted Paternal
1      gtgcgtgtgtccctgtccgcgctgctgaaacgggctcttcgagggatcggcgtcacatga     60
61     ctccgcctgcccctcgccagcgcgcagatcgccagtccctcagtttgcccggcaccggag    120
121    gagggtcgggcggcatcttccgggtactggggctctgcggagcggagaagaggttccagc    180
181    ggggaatggtatatctggattcaagaagccgcggctcggcgccagatcctggagtgtaga    240
241    tatttggggggaggggagagctagagggagcgagcgagcgagcgccagagagaggcagcg    300
301    cgcagcgcgcacggacggggggctgctgcgcggagaagatgtaagcgcgtggggtctcgc    360
4201   tgagcccagcccagacccagctgctcccggggacatgtgctagatgatactgtacatatt   4260
4261   cgtttggtttcactggattttcttcttcagtatgtgcttctccaagaatacaaatcgtcc   4320
4321   ttgttcttagattcctgtagaaccggaatatgaatttctgcaccgtttcagacttcgccc   4380
4381   acccatccctcccctcgtctcctgcagtgcctgtttcttttaaacagctgtactcttggt   4440
4441   ccctcttccctagactcctcactcttctcagaggggaaacagcacccttgcatacaagaa   4500
4501   tcttagactccagtcctgcttccgtccctccccagcccaggctcctgggttgaggtggcc   4560
4561   acccaggcatcctcccagcatgttccatgtagttgttataactgggtggggggtgggggg   4620
4621   cggcgggagggggaaaccataccctgaagtccagtcattgacaaatcttcccgctgatgg   4680
4681   tgatgtcaatttccaaagcagcttctccagccaaaatcgcaggtctcaaaactccccatg   4740
4741   tgtctcccagtaacctggacggaagggagtcctctctgctcagaaccacacccctcgtac   4800
4801   caatgctgccatctcgttcaggccccacgtcgctccttgctctaggattaacaccagata   4860
4861   gcatgaatagcagtctcaatacaactggatgaggccctagacttcccgaggaaatggagt   4920
4921   cacaaacaccaagccacgtcgactcttgccgaccactggcccagcatccactgaaagtcg   4980
4981   ggaacacaaaaatgtcacttttcctctttaagctgcctaacggtcactacaagcttacat   5040
5041   tgagatgctctaagtctgtataccttgtgataattagtaccacactgtagaattaggaaa   5100
5101   tcaataaccaagtgtttttattgcatatactgtagtcctgtctaaatgccttctagcagg   5160
5161   aatatagtaatgtagtgcttattctgtgaatattaccatgtattttttacactgtacagt   5220
5221   atagaaaacacaggttaactccgaagtggcaggcatgctccactacaacagacagacaac   5280
5281   ttttgctgtaagcaatacctagtggtatgagaattctatttcaagtcctaaaatatttca   5340
5341   acttacagcttgtttggaaaaaaatttccatttttgtaaaaatatatgtttcctgattac   5400
5401   ctcttgctaataaatctattctatctcagggtgaacagcgagttttgatgggtttcattc   5460
5461   gttcagtcaaggaatatttgatgagcacttgctccttacccagcccagcctgggaccgga   5520
5521   gatccagagtgtcaaggacaccatacctgctttttaggcaccaacagtttggtggggaag   5580
5581   actgtttcagttgcctattgcaccaagaacaagccactccaaaacataatggcttaaaac   5640
5641   catttttgttacctttcacagttctatgggttgactgggtccagctgtcagttcttattt   5700
5701   ggagtctctcatgaagtttcagtcactcagcaactgggactggagtcatctgaaggctca   5760
5761   actggaccgggtggtgctctagttggtgcaccaagatggcgctgtcacatggctggatgt   5820
5821   tgatgtctgctgggctgcactggggctgttcatgggagcatccacacgtggcctctctgt   5880
5881   gtggcttgggctcctcacagtccggaagctgggttccaagagcgactgttccagcagcct   5940
5941   caggcagaagctacaaggctgcccagatgccatcctgcccagatgtgtcctcactgtcac   6000
6001   ccaggaagggaagccccggaacaccaccctcagtcacaggcatggggcccactgcaaggc   6060
6061   acaacccactccagagctcccaaggccgcctcccctgggacctgcagccagctggctcca   6120
6121   taactgcttttccgtttcctccaggcattttcatcctagccctactttgtgctgggatct   6180
6181   gagggggatagcaagcggagaaagaagggatctagagggagaagattctagatccttctt   6240
6241   ttgactgccagctgattttgattgccagctttacctgcttcatgagctcagccaagtcac   6300
6301   ttaacctctcagagcttcactgttctcatctgaaaaatggggatgaaaatggtatctcat   6360
6361   tacagagtagaattaaatgaattattataattaaaaaaaaaaaaaaaaaaaaaa         6420