Imprinted Gene Databases

Homo sapiens: RASGRF1

Ras protein-specific guanine nucleotide-releasing factor 1
Species Gene Aliases Location Status Expressed Allele
Mus musculus Rasgrf1 Grf1, p190, CDC25, P190-A, CDC25Mm, Grfbeta, Ras-GRF1, p190RhoGEF  9 50.0 cM  Imprinted Paternal
Rattus norvegicus Rasgrf1   8q31  Imprinted Paternal
Sus scrofa RASGRF1 CDC25, CDC25L, GNRP, GRF1, GRF55, H-GRF55, PP13187  7 53.66  Imprinted Tissue Dependent
Homo sapiens RASGRF1 GNRP, GRF1, CDC25, GRF55, CDC25L, H-GRF55, PP13187  15q24.2  Unknown Unknown
1      gtgcgtgtgtccctgtccgcgctgctgaaacgggctcttcgagggatcggcgtcacatga     60
       ............................................................
61     ctccgcctgcccctcgccagcgcgcagatcgccagtccctcagtttgcccggcaccggag    120
       ............................................................
121    gagggtcgggcggcatcttccgggtactggggctctgcggagcggagaagaggttccagc    180
       ............................................................
181    ggggaatggtatatctggattcaagaagccgcggctcggcgccagatcctggagtgtaga    240
       ............................................................
241    tatttggggggaggggagagctagagggagcgagcgagcgagcgccagagagaggcagcg    300
       ............................................................
301    cgcagcgcgcacggacggggggctgctgcgcggagaagatgtaagcgcgtggggtctcgc    360
       ............................................................
361    tggcctctgagcaccATGCAGAAGGGGATCCGGCTGAATGATGGCCACGTCGCGTCCCTG    420
       ...............M--Q--K--G--I--R--L--N--D--G--H--V--A--S--L--
421    GGACTGCTGGCGCGCAAGGACGGCACGCGCAAAGGCTACCTGAGCAAGCGGAGTTCGGAC    480
       G--L--L--A--R--K--D--G--T--R--K--G--Y--L--S--K--R--S--S--D--
481    AACACAAAATGGCAAACCAAGTGGTTCGCGCTGCTGCAGAACCTGCTCTTCTACTTCGAG    540
       N--T--K--W--Q--T--K--W--F--A--L--L--Q--N--L--L--F--Y--F--E--
541    AGCGACTCGAGCTCGCGGCCCTCGGGGCTTTACCTGCTGGAGGGCTGCGTCTGCGACCGC    600
       S--D--S--S--S--R--P--S--G--L--Y--L--L--E--G--C--V--C--D--R--
601    GCGCCCTCCCCCAAGCCGGCGCTGTCGGCCAAGGAGCCGCTGGAGAAACAGCATTACTTC    660
       A--P--S--P--K--P--A--L--S--A--K--E--P--L--E--K--Q--H--Y--F--
661    ACGGTGAACTTCAGCCATGAGAACCAGAAAGCCTTGGAGCTGAGGACAGAGGACGCAAAA    720
       T--V--N--F--S--H--E--N--Q--K--A--L--E--L--R--T--E--D--A--K--
721    GATTGTGACGAATGGGTGGCAGCCATTGCACATGCCAGCTACAGGACCCTCGCCACAGAG    780
       D--C--D--E--W--V--A--A--I--A--H--A--S--Y--R--T--L--A--T--E--
781    CATGAGGCATTAATGCAGAAATACCTGCACCTGCTGCAGATCGTGGAGACAGAGAAGACC    840
       H--E--A--L--M--Q--K--Y--L--H--L--L--Q--I--V--E--T--E--K--T--
841    GTGGCCAAGCAGCTTCGGCAGCAGATCGAGGATGGGGAGATCGAGATCGAGCGGCTGAAG    900
       V--A--K--Q--L--R--Q--Q--I--E--D--G--E--I--E--I--E--R--L--K--
901    GCAGAGATCACATCCCTGCTCAAGGACAATGAGCGCATCCAGTCCACCCAGACTGTCGCC    960
       A--E--I--T--S--L--L--K--D--N--E--R--I--Q--S--T--Q--T--V--A--
961    CCCAACGATGAAGACAGCGACATCAAGAAAATTAAGAAGGTGCAGAGCTTCCTGCGGGGC   1020
       P--N--D--E--D--S--D--I--K--K--I--K--K--V--Q--S--F--L--R--G--
1021   TGGCTGTGCCGGCGGAAGTGGAAGACCATCATCCAGGACTACATCCGGTCACCCCATGCT   1080
       W--L--C--R--R--K--W--K--T--I--I--Q--D--Y--I--R--S--P--H--A--
1081   GACAGCATGCGCAAGAGGAACCAGGTGGTGTTCAGCATGCTGGAGGCTGAGGCTGAGTAC   1140
       D--S--M--R--K--R--N--Q--V--V--F--S--M--L--E--A--E--A--E--Y--
1141   GTGCAGCAGCTGCACATCCTTGTCAACAATTTCCTGCGCCCGCTGCGGATGGCCGCCAGC   1200
       V--Q--Q--L--H--I--L--V--N--N--F--L--R--P--L--R--M--A--A--S--
1201   TCCAAGAAGCCTCCCATCACACACGACGACGTCAGCAGCATCTTCCTGAACAGCGAAACC   1260
       S--K--K--P--P--I--T--H--D--D--V--S--S--I--F--L--N--S--E--T--
1261   ATCATGTTTTTACATCAGATCTTTTACCAAGGCCTGAAGGCCCGCATCTCCAGCTGGCCC   1320
       I--M--F--L--H--Q--I--F--Y--Q--G--L--K--A--R--I--S--S--W--P--
1321   ACGCTGGTCCTGGCTGACCTATTTGACATCCTGCTGCCCATGCTCAACATCTACCAAGAG   1380
       T--L--V--L--A--D--L--F--D--I--L--L--P--M--L--N--I--Y--Q--E--
1381   TTCGTCCGCAACCACCAGTACAGCCTGCAGATCCTGGCCCACTGCAAGCAGAACCGTGAC   1440
       F--V--R--N--H--Q--Y--S--L--Q--I--L--A--H--C--K--Q--N--R--D--
1441   TTCGACAAGCTGCTGAAGCACTACGAGGCCAAGCCTGACTGCGAGGAGAGGACGCTGGAG   1500
       F--D--K--L--L--K--H--Y--E--A--K--P--D--C--E--E--R--T--L--E--
1501   ACCTTCCTCACCTACCCCATGTTCCAGATCCCCAGGTACATCCTGACCCTCCATGAGCTC   1560
       T--F--L--T--Y--P--M--F--Q--I--P--R--Y--I--L--T--L--H--E--L--
1561   CTGGCCCACACGCCTCATGAGCACGTTGAGCGCAACAGCCTGGACTACGCCAAGTCCAAA   1620
       L--A--H--T--P--H--E--H--V--E--R--N--S--L--D--Y--A--K--S--K--
1621   CTGGAGGAGCTGTCCAGAATAATGCACGATGAAGTAAGTGAGACGGAGAACATCCGGAAA   1680
       L--E--E--L--S--R--I--M--H--D--E--V--S--E--T--E--N--I--R--K--
1681   AACCTGGCCATCGAGCGCATGATCATCGAAGGCTGTGAGATCCTCCTGGACACCAGCCAG   1740
       N--L--A--I--E--R--M--I--I--E--G--C--E--I--L--L--D--T--S--Q--
1741   ACCTTTGTGAGACAAGGTTCCCTCATTCAGGTGCCCATGTCTGAAAAGGGCAAGATCACC   1800
       T--F--V--R--Q--G--S--L--I--Q--V--P--M--S--E--K--G--K--I--T--
1801   AGGGGGCGCCTGGGGTCTCTCTCCCTAAAGAAAGAGGGCGAGCGACAGTGCTTCCTGTTT   1860
       R--G--R--L--G--S--L--S--L--K--K--E--G--E--R--Q--C--F--L--F--
1861   TCTAAGCATCTGATTATCTGTACCAGAGGCTCTGGAGGGAAGCTTCACTTGACCAAGAAT   1920
       S--K--H--L--I--I--C--T--R--G--S--G--G--K--L--H--L--T--K--N--
1921   GGAGTCATATCCCTCATTGACTGCACTTTATTGGAGGAGCCAGAAAGCACGGAGGAGGAA   1980
       G--V--I--S--L--I--D--C--T--L--L--E--E--P--E--S--T--E--E--E--
1981   GCCAAAGGATCCGGCCAAGACATAGATCACTTGGATTTTAAAATCGGGGTGGAGCCAAAG   2040
       A--K--G--S--G--Q--D--I--D--H--L--D--F--K--I--G--V--E--P--K--
2041   GATTCCCCGCCCTTTACAGTCATCCTAGTGGCCTCGTCCAGACAGGAGAAGGCAGCGTGG   2100
       D--S--P--P--F--T--V--I--L--V--A--S--S--R--Q--E--K--A--A--W--
2101   ACCAGTGACATCAGCCAGTGTGTGGATAACATCCGATGCAATGGGCTCATGATGAACGCA   2160
       T--S--D--I--S--Q--C--V--D--N--I--R--C--N--G--L--M--M--N--A--
2161   TTTGAAGAAAATTCCAAGGTCACTGTGCCGCAGATGATCAAGAGGACCAGGGAGGGGACC   2220
       F--E--E--N--S--K--V--T--V--P--Q--M--I--K--R--T--R--E--G--T--
2221   AGGGAAGCAGAAATGAGCAGGTCCGACGCCTCCTTATATTGTGATGATGTTGACATTCGC   2280
       R--E--A--E--M--S--R--S--D--A--S--L--Y--C--D--D--V--D--I--R--
2281   TTCAGCAAAACCATGAACTCCTGCAAAGTGCTGCAGATCCGCTACGCCAGTGTGGAGCGG   2340
       F--S--K--T--M--N--S--C--K--V--L--Q--I--R--Y--A--S--V--E--R--
2341   CTGCTGGAGAGGCTGACGGACCTGCGCTTCCTGAGCATCGACTTCCTCAACACCTTCCTG   2400
       L--L--E--R--L--T--D--L--R--F--L--S--I--D--F--L--N--T--F--L--
2401   CACTCCTACCGCGTCTTCACCACCGCCATCGTGGTCCTGGACAAGCTCATTACCATCTAC   2460
       H--S--Y--R--V--F--T--T--A--I--V--V--L--D--K--L--I--T--I--Y--
2461   AAGAAGCCTATCAGTGCCATTCCTGCCAGGTGGCTGAGGTCGCTGGAGCTCCTGTTTGCC   2520
       K--K--P--I--S--A--I--P--A--R--W--L--R--S--L--E--L--L--F--A--
2521   AGTGGCCAGAACAATAAGCTCCTGTACGGTGAACCCCCCAAGTCCCCGCGCGCCACCCGC   2580
       S--G--Q--N--N--K--L--L--Y--G--E--P--P--K--S--P--R--A--T--R--
2581   AAGTTCTCCTCGCCGCCACCTCTGTCCATCACCAAGACATCGTCACCGAGCCGCCGGCGG   2640
       K--F--S--S--P--P--P--L--S--I--T--K--T--S--S--P--S--R--R--R--
2641   AAGCTCTCCCTGAACATCCCCATCATCACTGGCGGCAAGGCCCTGGACCTGGCCGCCCTC   2700
       K--L--S--L--N--I--P--I--I--T--G--G--K--A--L--D--L--A--A--L--
2701   AGCTGCAACTCCAATGGCTACACCAGCATGTACTCGGCCATGTCACCCTTCAGCAAGGCC   2760
       S--C--N--S--N--G--Y--T--S--M--Y--S--A--M--S--P--F--S--K--A--
2761   ACGCTGGACACCAGCAAGCTCTATGTGTCCAGCAGCTTCACCAACAAGATTCCAGATGAG   2820
       T--L--D--T--S--K--L--Y--V--S--S--S--F--T--N--K--I--P--D--E--
2821   GGCGATACGACCCCTGAGAAGCCCGAAGACCCTTCAGCGCTCAGCAAGCAGAGCTCAGAA   2880
       G--D--T--T--P--E--K--P--E--D--P--S--A--L--S--K--Q--S--S--E--
2881   GTCTCCATGAGAGAGGAGTCAGATATTGATCAAAACCAGAGTGATGATGGTGATACTGAA   2940
       V--S--M--R--E--E--S--D--I--D--Q--N--Q--S--D--D--G--D--T--E--
2941   ACATCACCAACTAAATCTCCAACAACACCCAAATCAGTCAAAAACAAAAATTCTTCAGAG   3000
       T--S--P--T--K--S--P--T--T--P--K--S--V--K--N--K--N--S--S--E--
3001   TTCCCACTCTTTTCCTATAACAATGGAGTCGTCATGACCTCCTGTCGTGAACTGGACAAT   3060
       F--P--L--F--S--Y--N--N--G--V--V--M--T--S--C--R--E--L--D--N--
3061   AACCGCAGTGCCTTGTCGGCCGCCTCTGCCTTTGCCATAGCAACCGCCGGGGCCAACGAG   3120
       N--R--S--A--L--S--A--A--S--A--F--A--I--A--T--A--G--A--N--E--
3121   GGCACCCCAAACAAGGAGAAGTACCGGAGGATGTCCTTAGCCAGTGCAGGGTTTCCCCCA   3180
       G--T--P--N--K--E--K--Y--R--R--M--S--L--A--S--A--G--F--P--P--
3181   GACCAGAGGAATGGAGACAAGGAGTTTGTGATCCGCAGAGCAGCCACCAATCGTGTCTTG   3240
       D--Q--R--N--G--D--K--E--F--V--I--R--R--A--A--T--N--R--V--L--
3241   AACGTGCTCCGCCACTGGGTGTCCAAGCACTCTCAGGACTTTGAGACCAACGATGAGCTC   3300
       N--V--L--R--H--W--V--S--K--H--S--Q--D--F--E--T--N--D--E--L--
3301   AAATGCAAGGTGATCGGCTTCCTGGAAGAAGTCATGCACGACCCGGAGCTCCTGACCCAG   3360
       K--C--K--V--I--G--F--L--E--E--V--M--H--D--P--E--L--L--T--Q--
3361   GAGCGGAAGGCTGCAGCCAACATCATCAGGACTCTGACCCAGGAGGACCCAGGTGACAAC   3420
       E--R--K--A--A--A--N--I--I--R--T--L--T--Q--E--D--P--G--D--N--
3421   CAGATCACGCTGGAGGAGATCACGCAGATGGCTGAAGGCGTGAAGGCTGAGCCCTTTGAA   3480
       Q--I--T--L--E--E--I--T--Q--M--A--E--G--V--K--A--E--P--F--E--
3481   AACCACTCAGCCCTGGAGATCGCGGAGCAGCTGACCCTGCTAGATCACCTCGTCTTCAAG   3540
       N--H--S--A--L--E--I--A--E--Q--L--T--L--L--D--H--L--V--F--K--
3541   AAGATTCCTTATGAGGAGTTCTTCGGACAAGGATGGATGAAACTGGAAAAGAATGAAAGG   3600
       K--I--P--Y--E--E--F--F--G--Q--G--W--M--K--L--E--K--N--E--R--
3601   ACCCCTTATATCATGAAAACCACTAAGCACTTCAATGACATCAGTAACTTGATTGCTTCA   3660
       T--P--Y--I--M--K--T--T--K--H--F--N--D--I--S--N--L--I--A--S--
3661   GAAATCATCCGCAATGAGGACATCAACGCCAGGGTGAGCGCCATCGAGAAGTGGGTGGCC   3720
       E--I--I--R--N--E--D--I--N--A--R--V--S--A--I--E--K--W--V--A--
3721   GTAGCTGACATATGCCGCTGCCTCCACAACTACAATGCCGTACTGGAGATCACCTCGTCC   3780
       V--A--D--I--C--R--C--L--H--N--Y--N--A--V--L--E--I--T--S--S--
3781   ATGAACCGCAGTGCAATCTTCCGGCTCAAAAAGACGTGGCTCAAAGTCTCTAAGCAGACT   3840
       M--N--R--S--A--I--F--R--L--K--K--T--W--L--K--V--S--K--Q--T--
3841   AAAGCTTTGATTGATAAGCTCCAAAAGCTTGTGTCATCTGAGGGCAGATTTAAGAATCTC   3900
       K--A--L--I--D--K--L--Q--K--L--V--S--S--E--G--R--F--K--N--L--
3901   AGAGAAGCTCTGAAAAATTGTGACCCACCCTGTGTCCCTTACCTGGGGATGTACCTCACC   3960
       R--E--A--L--K--N--C--D--P--P--C--V--P--Y--L--G--M--Y--L--T--
3961   GACCTGGCCTTCATCGAGGAGGGGACGCCCAATTACACGGAAGACGGCCTGGTCAACTTC   4020
       D--L--A--F--I--E--E--G--T--P--N--Y--T--E--D--G--L--V--N--F--
4021   TCCAAGATGAGGATGATATCCCATATTATCCGAGAGATTCGCCAGTTTCAACAAACTGCC   4080
       S--K--M--R--M--I--S--H--I--I--R--E--I--R--Q--F--Q--Q--T--A--
4081   TACAAAATAGAGCACCAAGCAAAGGTAACGCAATATTTACTGGACCAATCTTTTGTAATG   4140
       Y--K--I--E--H--Q--A--K--V--T--Q--Y--L--L--D--Q--S--F--V--M--
4141   GATGAAGAAAGCCTCTACGAGTCTTCTCTCCGAATAGAACCAAAACTCCCCACCTGAagc   4200
       D--E--E--S--L--Y--E--S--S--L--R--I--E--P--K--L--P--T--***...
4201   tgagcccagcccagacccagctgctcccggggacatgtgctagatgatactgtacatatt   4260
       ............................................................
4261   cgtttggtttcactggattttcttcttcagtatgtgcttctccaagaatacaaatcgtcc   4320
       ............................................................
4321   ttgttcttagattcctgtagaaccggaatatgaatttctgcaccgtttcagacttcgccc   4380
       ............................................................
4381   acccatccctcccctcgtctcctgcagtgcctgtttcttttaaacagctgtactcttggt   4440
       ............................................................
4441   ccctcttccctagactcctcactcttctcagaggggaaacagcacccttgcatacaagaa   4500
       ............................................................
4501   tcttagactccagtcctgcttccgtccctccccagcccaggctcctgggttgaggtggcc   4560
       ............................................................
4561   acccaggcatcctcccagcatgttccatgtagttgttataactgggtggggggtgggggg   4620
       ............................................................
4621   cggcgggagggggaaaccataccctgaagtccagtcattgacaaatcttcccgctgatgg   4680
       ............................................................
4681   tgatgtcaatttccaaagcagcttctccagccaaaatcgcaggtctcaaaactccccatg   4740
       ............................................................
4741   tgtctcccagtaacctggacggaagggagtcctctctgctcagaaccacacccctcgtac   4800
       ............................................................
4801   caatgctgccatctcgttcaggccccacgtcgctccttgctctaggattaacaccagata   4860
       ............................................................
4861   gcatgaatagcagtctcaatacaactggatgaggccctagacttcccgaggaaatggagt   4920
       ............................................................
4921   cacaaacaccaagccacgtcgactcttgccgaccactggcccagcatccactgaaagtcg   4980
       ............................................................
4981   ggaacacaaaaatgtcacttttcctctttaagctgcctaacggtcactacaagcttacat   5040
       ............................................................
5041   tgagatgctctaagtctgtataccttgtgataattagtaccacactgtagaattaggaaa   5100
       ............................................................
5101   tcaataaccaagtgtttttattgcatatactgtagtcctgtctaaatgccttctagcagg   5160
       ............................................................
5161   aatatagtaatgtagtgcttattctgtgaatattaccatgtattttttacactgtacagt   5220
       ............................................................
5221   atagaaaacacaggttaactccgaagtggcaggcatgctccactacaacagacagacaac   5280
       ............................................................
5281   ttttgctgtaagcaatacctagtggtatgagaattctatttcaagtcctaaaatatttca   5340
       ............................................................
5341   acttacagcttgtttggaaaaaaatttccatttttgtaaaaatatatgtttcctgattac   5400
       ............................................................
5401   ctcttgctaataaatctattctatctcagggtgaacagcgagttttgatgggtttcattc   5460
       ............................................................
5461   gttcagtcaaggaatatttgatgagcacttgctccttacccagcccagcctgggaccgga   5520
       ............................................................
5521   gatccagagtgtcaaggacaccatacctgctttttaggcaccaacagtttggtggggaag   5580
       ............................................................
5581   actgtttcagttgcctattgcaccaagaacaagccactccaaaacataatggcttaaaac   5640
       ............................................................
5641   catttttgttacctttcacagttctatgggttgactgggtccagctgtcagttcttattt   5700
       ............................................................
5701   ggagtctctcatgaagtttcagtcactcagcaactgggactggagtcatctgaaggctca   5760
       ............................................................
5761   actggaccgggtggtgctctagttggtgcaccaagatggcgctgtcacatggctggatgt   5820
       ............................................................
5821   tgatgtctgctgggctgcactggggctgttcatgggagcatccacacgtggcctctctgt   5880
       ............................................................
5881   gtggcttgggctcctcacagtccggaagctgggttccaagagcgactgttccagcagcct   5940
       ............................................................
5941   caggcagaagctacaaggctgcccagatgccatcctgcccagatgtgtcctcactgtcac   6000
       ............................................................
6001   ccaggaagggaagccccggaacaccaccctcagtcacaggcatggggcccactgcaaggc   6060
       ............................................................
6061   acaacccactccagagctcccaaggccgcctcccctgggacctgcagccagctggctcca   6120
       ............................................................
6121   taactgcttttccgtttcctccaggcattttcatcctagccctactttgtgctgggatct   6180
       ............................................................
6181   gagggggatagcaagcggagaaagaagggatctagagggagaagattctagatccttctt   6240
       ............................................................
6241   ttgactgccagctgattttgattgccagctttacctgcttcatgagctcagccaagtcac   6300
       ............................................................
6301   ttaacctctcagagcttcactgttctcatctgaaaaatggggatgaaaatggtatctcat   6360
       ............................................................
6361   tacagagtagaattaaatgaattattataattaaaaaaaaaaaaaaaaaaaaaa         6420
       ......................................................