Imprinted Gene Databases

Homo sapiens: PRIM2

Primase, DNA, polypeptide 2

Chung et al., Epigenetics 7: 429-431, 2012

Species Gene Aliases Location Status Expressed Allele
Homo sapiens PRIM2 p58, PRIM2A  6p12-p11.1  Conflicting Data Biallelic
1      ggtttcatatgaactctcccgccacccgggaacagtggctgccaccgtttgtgttttccc     60
       ............................................................
61     gagtttgaattcttgcaggtgaccaagATGGAGTTTTCTGGAAGAAAGTGGAGGAAGCTG    120
       ...........................M--E--F--S--G--R--K--W--R--K--L--
121    AGGTTGGCAGGTGACCAGAGGAATGCTTCCTACCCTCATTGCCTTCAGTTTTACTTGCAG    180
       R--L--A--G--D--Q--R--N--A--S--Y--P--H--C--L--Q--F--Y--L--Q--
181    CCACCTTCTGAAAACATATCTTTAATAGAATTTGAAAACTTGGCTATTGATAGAGTTAAA    240
       P--P--S--E--N--I--S--L--I--E--F--E--N--L--A--I--D--R--V--K--
241    TTGTTAAAATCAGTTGAAAATCTTGGAGTGAGCTATGTGAAAGGAACTGAACAATACCAG    300
       L--L--K--S--V--E--N--L--G--V--S--Y--V--K--G--T--E--Q--Y--Q--
301    AGTAAGTTGGAGAGTGAGCTTCGGAAGCTCAAGTTTTCCTACAGAGAAAACTTAGAAGAT    360
       S--K--L--E--S--E--L--R--K--L--K--F--S--Y--R--E--N--L--E--D--
361    GAATATGAACCACGAAGAAGAGATCATATTTCTCATTTTATTTTGCGGCTTGCTTATTGC    420
       E--Y--E--P--R--R--R--D--H--I--S--H--F--I--L--R--L--A--Y--C--
421    CAGTCTGAAGAACTTAGACGCTGGTTCATTCAACAAGAAATGGATCTCCTTCGATTTAGA    480
       Q--S--E--E--L--R--R--W--F--I--Q--Q--E--M--D--L--L--R--F--R--
481    TTTAGTATTTTACCCAAGGATAAAATTCAGGATTTCTTAAAGGATAGCCAATTGCAGTTT    540
       F--S--I--L--P--K--D--K--I--Q--D--F--L--K--D--S--Q--L--Q--F--
541    GAGGCTATAAGTGATGAAGAGAAGACTCTTCGAGAACAGGAGATTGTTGCCTCATCACCA    600
       E--A--I--S--D--E--E--K--T--L--R--E--Q--E--I--V--A--S--S--P--
601    AGTTTAAGTGGACTTAAGTTGGGGTTCGAGTCCATTTATAAGATCCCTTTTGCTGATGCT    660
       S--L--S--G--L--K--L--G--F--E--S--I--Y--K--I--P--F--A--D--A--
661    CTGGATTTGTTTCGAGGAAGGAAAGTCTATTTGGAAGATGGCTTTGCTTACGTACCACTT    720
       L--D--L--F--R--G--R--K--V--Y--L--E--D--G--F--A--Y--V--P--L--
721    AAGGACATTGTGGCAATCATCCTGAATGAATTTAGAGCCAAACTGTCCAAGGCTTTGGCA    780
       K--D--I--V--A--I--I--L--N--E--F--R--A--K--L--S--K--A--L--A--
781    TTAACAGCCAGGTCCTTGCCTGCTGTGCAGTCTGATGAAAGACTTCAGCCTCTGCTCAAT    840
       L--T--A--R--S--L--P--A--V--Q--S--D--E--R--L--Q--P--L--L--N--
841    CACCTCAGTCATTCCTACACTGGCCAAGATTACAGTACCCAGGGAAATGTTGGGAAGATT    900
       H--L--S--H--S--Y--T--G--Q--D--Y--S--T--Q--G--N--V--G--K--I--
901    TCTTTAGATCAGATTGATTTGCTTTCTACCAAATCCTTCCCACCTTGCATGCGTCAGTTA    960
       S--L--D--Q--I--D--L--L--S--T--K--S--F--P--P--C--M--R--Q--L--
961    CATAAAGCCTTGCGGGAAAATCACCATCTTCGTCATGGAGGCCGAATGCAGTATGGCCTA   1020
       H--K--A--L--R--E--N--H--H--L--R--H--G--G--R--M--Q--Y--G--L--
1021   TTTCTGAAGGGCATTGGTTTAACTTTGGAACAGGCATTGCAGTTCTGGAAGCAAGAATTT   1080
       F--L--K--G--I--G--L--T--L--E--Q--A--L--Q--F--W--K--Q--E--F--
1081   ATCAAAGGAAAGATGGATCCAGACAAGTTTGATAAAGGTTACTCTTACAACATCCGTCAC   1140
       I--K--G--K--M--D--P--D--K--F--D--K--G--Y--S--Y--N--I--R--H--
1141   AGCTTTGGAAAGGAAGGCAAGAGGACAGACTATACACCTTTCAGTTGCCTGAAGATTATT   1200
       S--F--G--K--E--G--K--R--T--D--Y--T--P--F--S--C--L--K--I--I--
1201   CTGTCCAATCCACCAAGCCAAGGGGATTATCATGGGTGCCCATTCCGTCACAGTGATCCA   1260
       L--S--N--P--P--S--Q--G--D--Y--H--G--C--P--F--R--H--S--D--P--
1261   GAGCTGCTGAAGCAAAAGTTGCAGTCATACAAGATCTCTCCTGGAGGGATAAGCCAGATT   1320
       E--L--L--K--Q--K--L--Q--S--Y--K--I--S--P--G--G--I--S--Q--I--
1321   TTGGATTTAGTAAAGGGGACACATTACCAGGTAGCCTGTCAAAAATACTTTGAGATGATA   1380
       L--D--L--V--K--G--T--H--Y--Q--V--A--C--Q--K--Y--F--E--M--I--
1381   CACAATGTGGATGATTGTGGCTTTTCTTTGAATCATCCTAATCAGTTCTTTTGTGAGAGC   1440
       H--N--V--D--D--C--G--F--S--L--N--H--P--N--Q--F--F--C--E--S--
1441   CAACGTATTCTAAATGGTGGTAAAGACATAAAGAAGGAACCTATCCAACCAGAAACTCCT   1500
       Q--R--I--L--N--G--G--K--D--I--K--K--E--P--I--Q--P--E--T--P--
1501   CAACCCAAACCAAGTGTCCAGAAAACCAAGGATGCATCATCTGCTCTGGCCTCTTTAAAT   1560
       Q--P--K--P--S--V--Q--K--T--K--D--A--S--S--A--L--A--S--L--N--
1561   TCCTCTCTGGAAATGGATATGGAAGGACTAGAAGATTACTTTAGTGAAGATTCTTAGgca   1620
       S--S--L--E--M--D--M--E--G--L--E--D--Y--F--S--E--D--S--***...
1621   gttttataaccctttttcctcaatagcctgtttcctgtttttaagattttgcctttgttg   1680
       ............................................................
1681   ttgaaaaagggtttcactctgtcaccaaggcttagtgcagtgacacaattacagctgatt   1740
       ............................................................
1741   gcagccttgaccttcccagctcaagtgatcctcctacctcagcctcccaagtagttagga   1800
       ............................................................
1801   ccacaggtgtgcacctcatatccagataatttttttcaatttttttttgtagaggtgggg   1860
       ............................................................
1861   ggtctccctatgttgcccaggcagatctcagactcctgggctcaagcgatcctcacacct   1920
       ............................................................
1921   cagcgtcccagagtgctgggattacggttgtgagccactgtgcctggccttttttttttt   1980
       ............................................................
1981   ttttaacctttttgtttaacttctctcttcactgcatcccaatccatctacaggcatgca   2040
       ............................................................
2041   cacttattaggaaaggaggtttgaggtaacaacagagactttcactatattttgctttga   2100
       ............................................................
2101   cagaaggaaagaggaggagtttctattaaaatctgtcacttgagtgatgtcatttaagtc   2160
       ............................................................
2161   ctattttaggagataaaaacagctttggggactggttaaagtcccccagaaactacaata   2220
       ............................................................
2221   aagaacaacttttgttttaactcttaatcactttgtaattttgactcaatccttttctgg   2280
       ............................................................
2281   accatttttgttaataaatatcaaagtgtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa   2340
       ............................................................
2341   aaaaaaaaaaaaa                                                  2400
       .............