Imprinted Gene Databases

Homo sapiens: PPP1R9A

Protein phosphatase 1, regulatory subunit 9A
Species Gene Aliases Location Status Expressed Allele
Mus musculus Ppp1r9a BB181831, mKIAA1222, 5330407E15, neurabin-I, 2810430P21Rik, 4930518N04Rik, A230094E16Rik  6 0.5 cM  Imprinted Maternal
Homo sapiens PPP1R9A NRB1, NRBI, FLJ20068, KIAA1222, Neurabin-I  7q21.3  Imprinted Maternal
1      ctctcccgggattttgctgccgggctccctctctctgcggccctagagttaatcccatca     60
       ............................................................
61     gccgagatgaacctctagtcttgctttgaaaaaatcattctgtgtaactcttgactgtga    120
       ............................................................
121    ctaagttcctaatacacctgttgggacgatcactgacaccgtataccatttgagaggtac    180
       ............................................................
181    ttttcttgacccaatactggtgattagagaagagaggtatcttggtttttggtttttttc    240
       ............................................................
241    tttgatcattatgaacattggcttttcacccctgaagtgaaaATGTTGAAAACTGAGTCT    300
       ..........................................M--L--K--T--E--S--
301    TCAGGTGAACGAACCACTCTCAGAAGTGCCTCTCCTCACAGGAATGCATATCGAACTGAG    360
       S--G--E--R--T--T--L--R--S--A--S--P--H--R--N--A--Y--R--T--E--
361    TTTCAGGCACTGAAAAGTACCTTTGACAAACCCAAGTCAGATGGGGAACAAAAAACAAAA    420
       F--Q--A--L--K--S--T--F--D--K--P--K--S--D--G--E--Q--K--T--K--
421    GAAGGTGAGGGCTCCCAGCAGAGCAGGGGGAGGAAATATGGCTCCAATGTCAACAGAATT    480
       E--G--E--G--S--Q--Q--S--R--G--R--K--Y--G--S--N--V--N--R--I--
481    AAAAACCTATTTATGCAGATGGGTATGGAACCCAACGAGAATGCTGCAGTCATTGCCAAA    540
       K--N--L--F--M--Q--M--G--M--E--P--N--E--N--A--A--V--I--A--K--
541    ACAAGGGGGAAAGGTGGACATTCATCTCCTCAGAGAAGAATGAAGCCCAAAGAATTTCTG    600
       T--R--G--K--G--G--H--S--S--P--Q--R--R--M--K--P--K--E--F--L--
601    GAAAAAACAGATGGCTCAGTTGTTAAGTTGGAGTCTTCTGTTTCTGAACGAATTAGTAGA    660
       E--K--T--D--G--S--V--V--K--L--E--S--S--V--S--E--R--I--S--R--
661    TTTGACACTATGTACGATGGCCCTTCATATTCCAAGTTCACTGAGACTCGAAAGATGTTT    720
       F--D--T--M--Y--D--G--P--S--Y--S--K--F--T--E--T--R--K--M--F--
721    GAGAGAAGTGTGCATGAATCAGGACAGAACAACCGCTATTCCCCAAAGAAAGAGAAAGCT    780
       E--R--S--V--H--E--S--G--Q--N--N--R--Y--S--P--K--K--E--K--A--
781    GGAGGGAGTGAACCTCAGGATGAATGGGGAGGTTCCAAGTCCAACAGAGGCAGTACTGAT    840
       G--G--S--E--P--Q--D--E--W--G--G--S--K--S--N--R--G--S--T--D--
841    TCCTTGGACAGCCTTAGCTCCCGAACTGAGGCTGTCTCCCCAACTGTGAGTCAACTGAGT    900
       S--L--D--S--L--S--S--R--T--E--A--V--S--P--T--V--S--Q--L--S--
901    GCAGTATTTGAGAACACTGATTCTCCCAGTGCCATCATTTCTGAGAAGGCTGAAAACAAT    960
       A--V--F--E--N--T--D--S--P--S--A--I--I--S--E--K--A--E--N--N--
961    GAATACTCAGTGACTGGGCATTATCCCTTGAATTTACCATCTGTTACTGTTACAAATCTT   1020
       E--Y--S--V--T--G--H--Y--P--L--N--L--P--S--V--T--V--T--N--L--
1021   GACACATTTGGTCACCTGAAGGATTCTAATTCCTGGCCTCCTTCAAACAAGCGAGGTGTT   1080
       D--T--F--G--H--L--K--D--S--N--S--W--P--P--S--N--K--R--G--V--
1081   GATACAGAGGATGCTCACAAGAGTAATGCAACTCCAGTACCAGAAGTGGCTTCTAAAAGT   1140
       D--T--E--D--A--H--K--S--N--A--T--P--V--P--E--V--A--S--K--S--
1141   ACCTCTCTAGCTTCGATACCTGGTGAAGAGATCCAGCAGAGCAAGGAACCCGAGGACTCC   1200
       T--S--L--A--S--I--P--G--E--E--I--Q--Q--S--K--E--P--E--D--S--
1201   ACATCTAATCAACAGACTCCCGACAGCATTGACAAAGATGGTCCTGAAGAACCTTGTGCT   1260
       T--S--N--Q--Q--T--P--D--S--I--D--K--D--G--P--E--E--P--C--A--
1261   GAAAGTAAGGCAATGCCAAAGTCCGAAATCCCTTCACCACAAAGCCAACTGTTAGAAGAT   1320
       E--S--K--A--M--P--K--S--E--I--P--S--P--Q--S--Q--L--L--E--D--
1321   GCTGAAGCTAATTTGGTTGGAAGGGAGGCAGCAAAGCAACAGAGGAAAGAACTTGCAGGT   1380
       A--E--A--N--L--V--G--R--E--A--A--K--Q--Q--R--K--E--L--A--G--
1381   GGTGATTTCACCTCTCCTGATGCTTCTGCATCCAGTTGTGGAAAAGAAGTACCTGAAGAT   1440
       G--D--F--T--S--P--D--A--S--A--S--S--C--G--K--E--V--P--E--D--
1441   TCAAATAATTTTGATGGTTCCCATGTGTACATGCACAGTGACTATAATGTGTATAGGGTG   1500
       S--N--N--F--D--G--S--H--V--Y--M--H--S--D--Y--N--V--Y--R--V--
1501   AGATCCAGGTATAATTCAGACTGGGGAGAGACAGGCACTGAGCAGGATGAGGAGGAAGAT   1560
       R--S--R--Y--N--S--D--W--G--E--T--G--T--E--Q--D--E--E--E--D--
1561   AGTGATGAGAACAGTTACTATCAGCCTGATATGGAGTACTCGGAAATTGTTGGATTGCCA   1620
       S--D--E--N--S--Y--Y--Q--P--D--M--E--Y--S--E--I--V--G--L--P--
1621   GAAGAAGAAGAAATCCCAGCAAATAGGAAAATTAAGTTTAGTAGTGCTCCTATTAAGGTT   1680
       E--E--E--E--I--P--A--N--R--K--I--K--F--S--S--A--P--I--K--V--
1681   TTCAACACATACTCCAATGAAGACTATGACAGGAGAAATGACGAAGTTGACCCTGTGGCT   1740
       F--N--T--Y--S--N--E--D--Y--D--R--R--N--D--E--V--D--P--V--A--
1741   GCTTCAGCTGAGTATGAACTTGAAAAACGTGTAGAAAAGCTGGAACTTTTCCCAGTGGAG   1800
       A--S--A--E--Y--E--L--E--K--R--V--E--K--L--E--L--F--P--V--E--
1801   CTAGAGAAAGATGAGGATGGTCTTGGTATAAGTATTATTGGAATGGGTGTTGGAGCAGAT   1860
       L--E--K--D--E--D--G--L--G--I--S--I--I--G--M--G--V--G--A--D--
1861   GCTGGACTTGAAAAGCTGGGAATATTCGTCAAGACAGTAACAGAAGGTGGTGCTGCTCAA   1920
       A--G--L--E--K--L--G--I--F--V--K--T--V--T--E--G--G--A--A--Q--
1921   CGGGATGGCAGAATACAAGTCAATGACCAGATTGTGGAAGTGGATGGAATCAGCTTGGTG   1980
       R--D--G--R--I--Q--V--N--D--Q--I--V--E--V--D--G--I--S--L--V--
1981   GGTGTGACACAGAATTTTGCAGCAACAGTTCTCAGAAACACCAAGGGCAACGTCAGATTT   2040
       G--V--T--Q--N--F--A--A--T--V--L--R--N--T--K--G--N--V--R--F--
2041   GTTATTGGGCGGGAAAAACCAGGACAAGTGAGCGAGGTTGCCCAGTTGATAAGCCAGACA   2100
       V--I--G--R--E--K--P--G--Q--V--S--E--V--A--Q--L--I--S--Q--T--
2101   CTGGAACAGGAGAGGCGCCAGAGAGAGCTGCTGGAACAGCACTATGCCCAGTATGATGCC   2160
       L--E--Q--E--R--R--Q--R--E--L--L--E--Q--H--Y--A--Q--Y--D--A--
2161   GACGATGACGAGACAGGAGAATATGCCACAGATGAAGAAGAAGATGAGGTAGGACCTGTC   2220
       D--D--D--E--T--G--E--Y--A--T--D--E--E--E--D--E--V--G--P--V--
2221   CTTCCTGGCAGCGACATGGCCATTGAAGTCTTTGAGCTGCCTGAGAATGAGGACATGTTT   2280
       L--P--G--S--D--M--A--I--E--V--F--E--L--P--E--N--E--D--M--F--
2281   TCCCCATCAGAACTGGACACAAGCAAGCTCAGTCACAAGTTCAAAGAGTTGCAAATCAAA   2340
       S--P--S--E--L--D--T--S--K--L--S--H--K--F--K--E--L--Q--I--K--
2341   CATGCAGTTACAGAAGCAGAGATTCAAAAATTGAAGACCAAGCTGCAGGCAGCAGAAAAT   2400
       H--A--V--T--E--A--E--I--Q--K--L--K--T--K--L--Q--A--A--E--N--
2401   GAGAAAGTGAGGTGGGAACTAGAAAAAACCCAACTCCAACAAAACATAGAAGAGAATAAG   2460
       E--K--V--R--W--E--L--E--K--T--Q--L--Q--Q--N--I--E--E--N--K--
2461   GAAAGAATGTTGAAGTTGGAAAGCTACTGGATTGAGGCCCAAACATTATGCCACACAGTG   2520
       E--R--M--L--K--L--E--S--Y--W--I--E--A--Q--T--L--C--H--T--V--
2521   AATGAGCATCTCAAAGAGACTCAAAGCCAGTATCAGGCCTTGGAAAAGAAATACAACAAG   2580
       N--E--H--L--K--E--T--Q--S--Q--Y--Q--A--L--E--K--K--Y--N--K--
2581   GCAAAGAAGTTGATCAAGGATTTTCAACAAAAAGAGCTTGATTTCATCAAAAGACAGGAA   2640
       A--K--K--L--I--K--D--F--Q--Q--K--E--L--D--F--I--K--R--Q--E--
2641   GCAGAAAGAAAGAAAATAGAAGATTTGGAAAAAGCTCATCTTGTGGAAGTGCAAGGCCTC   2700
       A--E--R--K--K--I--E--D--L--E--K--A--H--L--V--E--V--Q--G--L--
2701   CAAGTGCGGATTAGAGATTTGGAAGCTGAGGTATTCAGGCTACTGAAGCAAAATGGGACT   2760
       Q--V--R--I--R--D--L--E--A--E--V--F--R--L--L--K--Q--N--G--T--
2761   CAAGTTAACAATAATAACAACATCTTTGAGAGAAGAACATCTCTTGGTGAAGTCTCTAAA   2820
       Q--V--N--N--N--N--N--I--F--E--R--R--T--S--L--G--E--V--S--K--
2821   GGGGATACCATGGAGAACTTGGATGGCAAGCAGACATCTTGCCAAGATGGCCTAAGTCAA   2880
       G--D--T--M--E--N--L--D--G--K--Q--T--S--C--Q--D--G--L--S--Q--
2881   GACTTGAATGAAGCAGTCCCAGAGACAGAGCGCCTGGATTCAAAAGCACTGAAAACTCGA   2940
       D--L--N--E--A--V--P--E--T--E--R--L--D--S--K--A--L--K--T--R--
2941   GCCCAGCTCTCTGTGAAGAACAGACGCCAGAGACCCTCTAGGACAAGACTGTATGATAGT   3000
       A--Q--L--S--V--K--N--R--R--Q--R--P--S--R--T--R--L--Y--D--S--
3001   GTTAGTTCCACAGATGGGGAGGACAGTCTAGAGAGAAAGAATTTTACCTTCAATGATGAC   3060
       V--S--S--T--D--G--E--D--S--L--E--R--K--N--F--T--F--N--D--D--
3061   TTCAGTCCCAGCAGTACCAGTTCAGCAGACCTCAGCGGCTTAGGAGCAGAACCTAAAACA   3120
       F--S--P--S--S--T--S--S--A--D--L--S--G--L--G--A--E--P--K--T--
3121   CCAGGGCTCTCTCAGTCCTTAGCACTGTCATCAGATGAGAGCCTGGATATGATAGATGAC   3180
       P--G--L--S--Q--S--L--A--L--S--S--D--E--S--L--D--M--I--D--D--
3181   GAGATCCTTGATGATGGACAGTCTCCCAAACACAGTCAGTGTCAGAATCGGGCCGTTCAG   3240
       E--I--L--D--D--G--Q--S--P--K--H--S--Q--C--Q--N--R--A--V--Q--
3241   GAATGGAGTGTGCAGCAGGTTTCTCACTGGTTAATGAGCCTAAATCTGGAGCAGTATGTA   3300
       E--W--S--V--Q--Q--V--S--H--W--L--M--S--L--N--L--E--Q--Y--V--
3301   TCTGAATTCAGTGCCCAAAACATCACTGGAGAACAGCTCCTGCAGTTGGATGGAAATAAA   3360
       S--E--F--S--A--Q--N--I--T--G--E--Q--L--L--Q--L--D--G--N--K--
3361   CTTAAGGCTCTTGGAATGACAGCATCCCAGGACCGAGCAGTGGTCAAAAAGAAACTCAAG   3420
       L--K--A--L--G--M--T--A--S--Q--D--R--A--V--V--K--K--K--L--K--
3421   GAAATGAAGATGTCTCTAGAGAAGGCTCGGAAGGCCCAAGAGAAAATGGAAAAACAAAGA   3480
       E--M--K--M--S--L--E--K--A--R--K--A--Q--E--K--M--E--K--Q--R--
3481   GAAAAGCTAAGGAGAAAGGAGCAAGAGCAAATGCAGAGGAAGTCCAAAAAGACAGAAAAG   3540
       E--K--L--R--R--K--E--Q--E--Q--M--Q--R--K--S--K--K--T--E--K--
3541   ATGACGTCAACTACAGCCGAGGGTGCTGGTGAGCAGTAAcacataccctcttacagatga   3600
       M--T--S--T--T--A--E--G--A--G--E--Q--***.....................
3601   tggagatgctccaagagaagtccccacctcttcctgccctgctctcctccagaggatgaa   3660
       ............................................................
3661   aaagaaactaaatgataagggtaatgcggctctaggccggctgaggaactgtgtgttgaa   3720
       ............................................................
3721   taactgcattttctgcaatagaatgcactcttaattttaactactaaaataatcccaagc   3780
       ............................................................
3781   cacctttggttcattaacaaaccagagatttcatttaagtagctgtgttttgctcttctc   3840
       ............................................................
3841   taacttaccaacatcttgtgttgtgttgggtgtgttttgtcacttggagaactagtgtga   3900
       ............................................................
3901   ccccacccaagagcatgacacaccctggtgttgttaatggagcgccgtgaattttcagtg   3960
       ............................................................
3961   tgggatcctgaaatggcaattgcacatgtctgcatggcagagagcaccctgccatgagat   4020
       ............................................................
4021   ctgagaccagtacttaacttctaggactgcaacacctactccaatgtgtgggaaagattt   4080
       ............................................................
4081   gctcttaattctcagtctggacagtgagaccaccccgctgtggaaacatgggtgctctgc   4140
       ............................................................
4141   tctgtagttacctactaagggaaaaggcaagcaagtcattctgcttgctaggcatcaaaa   4200
       ............................................................
4201   agaaagaaaataaattatagctatttgttaaccactgaaaaaagcaaaagccttaagaat   4260
       ............................................................
4261   gtggatgtgggtattaccttggggttctgagggtaatatttatcctctagatacggctga   4320
       ............................................................
4321   acaagaaagaaaaaaatcagacattaatgcagccatgggatattgggatctgttgacctt   4380
       ............................................................
4381   gctactgctgtgtgttcagcatttcagcaacactggcaaacacaacacagttcctcttcc   4440
       ............................................................
4441   ccctacctaacccaagaaattgaacaggaaattgatttttaaggaaaccaccattttcag   4500
       ............................................................
4501   gtttcctctcctggggaacattctggctggtcttcagcctgcctatgtcacaatcaggaa   4560
       ............................................................
4561   ctcatcacatattttctactcaagatttcccaggtgggctcagttagtattttaacaaat   4620
       ............................................................
4621   gtacttttaagaaaaatagaaataccagttagaggaaactgtcagttaacattttagaga   4680
       ............................................................
4681   gattttgaatggtttttccgaaccattcctttccatacttcaaagattctcaattttaca   4740
       ............................................................
4741   gaaaaagtttgtttaaggcagtgcataggtatactttagtagtggaggaacttatactaa   4800
       ............................................................
4801   ttttaagccagcattaaggatttccatgtttcaccaaactaagtcaagtgcaggagactg   4860
       ............................................................
4861   gggcagaagaaggagaaaataaactcgttttgagaaatttcatgtgatgagggttttttg   4920
       ............................................................
4921   ttttttatgctcatgtatctggttctctttgctgcgttgactctaaaaatgaggttatcc   4980
       ............................................................
4981   actttccaaaggacaagtttcagaataagacttgaggccacatgaattcttggacagtat   5040
       ............................................................
5041   tttacttcttttactttatgggaatctctgctctgttcccagcatctcgtatcttccact   5100
       ............................................................
5101   agaagtattccatatttagagcctcggcaaggcttttgagtgtaacagattaagggaact   5160
       ............................................................
5161   cccttgtagccccatcttgtattttaataacagtgtgatttttttttatctgaaaatctg   5220
       ............................................................
5221   aattcagaaattatctaaactggacatttttaattctgttttacccccaaggcctgtttt   5280
       ............................................................
5281   cttttcattgccagagtattgtcggttatgcgtcagctcttttgtcattaggtacagacc   5340
       ............................................................
5341   cttcattcaatcctcagaaacgttgacatgaagtaacattgtgttttacagttatcaaag   5400
       ............................................................
5401   tcaccattatgtttttctgtctgtcttcattaggggtatgataatgaaactgccgtattg   5460
       ............................................................
5461   gatactctattaatgtcttgagatgtctggtgctttgttattttttcacatcatgagaaa   5520
       ............................................................
5521   taagaagccactattaatgagtgatacaatttggcaaaacttttcaaatactaaaacact   5580
       ............................................................
5581   aaattagtaaaaatctggtaatattagtgcttgctattgtaaatttttgccatttttgct   5640
       ............................................................
5641   tatctttgggaaaaaagtgacctggatcacactggaagtttcactgtattcaagagtaga   5700
       ............................................................
5701   aatagaaggatgattatcttaagttatgtttacactttggtaatatttgaaaatggatgt   5760
       ............................................................
5761   atatactggaaatgtctgtaagtgtcttgtttttgcacctaatttatgatctattatatt   5820
       ............................................................
5821   gcattttcttaaatatcttagaagtatttttctttataactttgtatattgaatgtttag   5880
       ............................................................
5881   ataaatgtccaactgacaatgttataaatcaaattcttattcctaaaatcatttagtatt   5940
       ............................................................
5941   ataagtattttgattttttaagttaaattatagtaattttaggccgaagtgagttatttt   6000
       ............................................................
6001   aacattaccacttaaaacggatgaaattgtaaaagtcatttggtttgattgccccacaaa   6060
       ............................................................
6061   gcataagatgtaaactgattaagggtatgaaagcaaagtgaaagacctcagatcttgtgc   6120
       ............................................................
6121   acattttgttttcctattatttcttttattgactgtagtgcatgatacctaatcaaggct   6180
       ............................................................
6181   ccaatgtcttgcacaattcctactttaatgctagtggttttcagtgtccttacaatttaa   6240
       ............................................................
6241   cacagaattgttatttcatcaaccttaaaaactgcagtttttattatcagaaaatgaaca   6300
       ............................................................
6301   aaaagggaatatctggttgctatgaactgattccctaaaggagagctcagtatgattcta   6360
       ............................................................
6361   acaatagccaaaagtgttttggggtataggttatgctttgttgggagggaatgtgtggtg   6420
       ............................................................
6421   aggaggccaagctgcagacagaaagcattgtatgagctgtatctgggtcagggtttccca   6480
       ............................................................
6481   ttaaaggatgttagttttataacagattactttgtttaagaccatctcccttcaagtaac   6540
       ............................................................
6541   tcacagtttatgtaatactaatctcattctttttttacctgaatcaggaattttctgcag   6600
       ............................................................
6601   aatgttaagttagggaagaaacctcatttcatccattctaacactcctgatgaagtcccc   6660
       ............................................................
6661   ctttagtttcatgacaataaagctgttctgtggctatcatcctttagctgggattgacaa   6720
       ............................................................
6721   ttgatttcacaccctcaacatcacaagctttttttaacccacagcagttcatgattgcag   6780
       ............................................................
6781   tatgataggtactaaagccaaactcagctttcaactggcacaaaatgggactgtcacctt   6840
       ............................................................
6841   ttgctccattgttgttggaaacaaagtggcaagagggaaaatgaggaaccagatttacct   6900
       ............................................................
6901   ttgccactatctgtgaccctgtaatcatcactagcctgaaatcttaaaatatcccagtcc   6960
       ............................................................
6961   caagctacaaaaatggtcacaggtggtttgatctagcacctcggccgttagagtttgtgc   7020
       ............................................................
7021   tgaagacaaatttgtctgggttcattgtgcaccagaattagcatgtgcttgaaaattgca   7080
       ............................................................
7081   ttttataaaagggaaatgaaaatttgcatttatatagatactctgattcatgtttaagtg   7140
       ............................................................
7141   ttaaaggttatgcagactaaacttcaagaggagatccagtgtttaacaatagtgttctag   7200
       ............................................................
7201   aggattctaaaggaagctgccccagcagccctgagagaaccatctatactttggatatgt   7260
       ............................................................
7261   tgtagccccatcattacactgagatatttccatttgagtaactaaaggtactcctgacag   7320
       ............................................................
7321   agctggagatgaggggcattttggtgggcagtggtcactagggttcacgtcacctactta   7380
       ............................................................
7381   atgcaaagaccttagtggtctcagaatgaaaaggtaaaatggaagagaaaagcacagtcc   7440
       ............................................................
7441   tttcctgtcttttcaaatttactttttattaaggatgtacctgtgcactattctaaagct   7500
       ............................................................
7501   aagcatttaaggataaagtccagaaataaaatgtccatattttcttttcttttctttttt   7560
       ............................................................
7561   tttttttttttctgtcatctgtcacccagactggactgcagtggtgccatcatgtcttac   7620
       ............................................................
7621   tgcagcctcaaactcctgggctcaagtggtcctcctgcttcagcttcccaagtagctggg   7680
       ............................................................
7681   actacaggcatgtgccaccacccccagccaaaacatccatattttctattagaatggttt   7740
       ............................................................
7741   acattatgatgggggatggggagctgggggagggctgtacattcccaaaagaaagtagtg   7800
       ............................................................
7801   ttataggaaatccaaatgcgcttcagtgattcactcctgaaaagcagcctgggtatgttg   7860
       ............................................................
7861   gcagattttgtttgcatttgtcttgcgtatttaaagtctcaggaaatctagtcttggtcc   7920
       ............................................................
7921   aaaacactggagaaaaaaataacaccagacaaaacacatttgagtaacttgaagtagcag   7980
       ............................................................
7981   catagaataggcccaactaagaagttggaggggcaaagagaaagccgacagaatcagctt   8040
       ............................................................
8041   ctcctggaaagtgaaagcatcaagttctatttatggtagacagagggtccttatttgctt   8100
       ............................................................
8101   gtccgtggtgtctatgtgggcctattgagggaatggtagttacttgaaggttcacatatg   8160
       ............................................................
8161   taagcgtgtggacccagcacagtctgtgacctgattccagatcctcaagagtggagaagg   8220
       ............................................................
8221   aaagaaatatgatgatttcctatgcttgaccctaacccaaccccaaaactgctagggatt   8280
       ............................................................
8281   caacagtgagtaagatgtatgcaataagagaacagataacttctcaacaatgtgcatgcc   8340
       ............................................................
8341   gtttgtgtagatgttcagaactacatatgtgtgaatatcactcccaccttacacacgcac   8400
       ............................................................
8401   acacactgcaatcacatggcattaaaaaatatattgtgtatggaacttggcgaggtcagt   8460
       ............................................................
8461   caggacctggagctgtaatcatagccttattgccacttcttgcgttgtgtatacattgaa   8520
       ............................................................
8521   tggctcatagattttaagagatttttttattgtaagtatttctactaaatgcacttatcc   8580
       ............................................................
8581   ttctatatgtttatatattttggtaaaattgatttatcagatacttggtattttagtaag   8640
       ............................................................
8641   aaaatttcctcaaatatttggctaatgctttgatgtcaagattgcatattgctgagttgg   8700
       ............................................................
8701   agctcagaagaaatgtatgcagctaaaaattgcactgtgtgttcttgtgaatttgctcac   8760
       ............................................................
8761   aattctaaaatgacataattggtggctgtgatgcttacagtcactgcctactggctctct   8820
       ............................................................
8821   tatgatgaatgttgccatcatatgatcatttatttactttttgtgcaagcaatggcattt   8880
       ............................................................
8881   tggttgttgccaaaaacaacacaagtggttgggagtgtatgttgttggaaggtgtacact   8940
       ............................................................
8941   tctgtttctttcagctgtattatttatacacccaggttttctgttaaggatgtaatcatt   9000
       ............................................................
9001   cattcaagaaagaacaattggcaagaaataattaaattaccttaaaaagaattaagaggc   9060
       ............................................................
9061   actccagccagataacacctcccaacaacatgaaatttagttagtgcttagtgaaattcc   9120
       ............................................................
9121   ttaaatatatatgtatatgttttcttcaacattatttaatataactactgcttttatatt   9180
       ............................................................
9181   ttttaatggtgttgcaaccacttgtacacctgctacaccttactgacaaaactgggcagc   9240
       ............................................................
9241   tgaaaataaaagagaataaattctattccactgtaagaagttgatttcttttcagctttc   9300
       ............................................................
9301   tttgtatatcagtaaagaacacgaattgtttgaaaataattttaagtctgataagtatgg   9360
       ............................................................
9361   atagcatgttacctaagcttttaatttgtacattttgatgtctgatcatttgcatggaag   9420
       ............................................................
9421   agacaatagtgccacgtctgaattgttctcttgtgcttggttaatatgtacttctctaga   9480
       ............................................................
9481   ttgttcaaaaagtttcaaatgacattccttactctttggttttcagaggcattcaagcaa   9540
       ............................................................
9541   aatatcacagtggtcttttgttttctgaccaatctaacaatacctgtgattaaatttaat   9600
       ............................................................
9601   ttgttagtgtaaataaatttcttgccaatgagtattattgttgttagacaacgaatgcaa   9660
       ............................................................
9661   taaaaagaaatactgaggtctgttgaagcaaaaaaaaaaaaaaaa                  9720
       .............................................