Imprinted Gene Databases

Homo sapiens: PON3

Paraoxonase 3
Species Gene Aliases Location Status Expressed Allele
Homo sapiens PON3   7q21.3  Not Imprinted Biallelic
Mus musculus Pon3 AI786302, 2810004E20  6 0.5 cM  Provisional Data Maternal
1      agtcgccgctgggcaccccgagaccATGGGGAAGCTCGTGGCGCTGGTCCTGCTGGGGGT     60
       .........................M--G--K--L--V--A--L--V--L--L--G--V-
61     CGGCCTGTCCTTAGTCGGGGAGATGTTCCTGGCGTTTAGAGAAAGGGTGAATGCCTCTCG    120
       -G--L--S--L--V--G--E--M--F--L--A--F--R--E--R--V--N--A--S--R-
121    AGAAGTGGAGCCAGTAGAACCTGAAAACTGCCACCTTATTGAGGAACTTGAAAGTGGCTC    180
       -E--V--E--P--V--E--P--E--N--C--H--L--I--E--E--L--E--S--G--S-
181    TGAAGATATTGATATACTTCCTAGTGGGCTGGCTTTTATCTCCAGTGGATTAAAATATCC    240
       -E--D--I--D--I--L--P--S--G--L--A--F--I--S--S--G--L--K--Y--P-
241    AGGCATGCCAAACTTTGCGCCAGATGAACCAGGAAAAATCTTCTTGATGGATCTGAATGA    300
       -G--M--P--N--F--A--P--D--E--P--G--K--I--F--L--M--D--L--N--E-
301    ACAAAACCCAAGGGCACAAGCGCTAGAAATCAGTGGTGGATTTGACAAAGAATTATTTAA    360
       -Q--N--P--R--A--Q--A--L--E--I--S--G--G--F--D--K--E--L--F--N-
361    TCCACATGGGATCAGTATTTTCATCGACAAAGACAATACTGTGTATCTTTATGTTGTGAA    420
       -P--H--G--I--S--I--F--I--D--K--D--N--T--V--Y--L--Y--V--V--N-
421    TCATCCCCACATGAAGTCCACTGTGGAGATATTTAAATTTGAGGAACAACAACGTTCTCT    480
       -H--P--H--M--K--S--T--V--E--I--F--K--F--E--E--Q--Q--R--S--L-
481    GGTATACCTGAAAACTATAAAACATGAACTTCTCAAAAGTGTGAATGACATTGTGGTTCT    540
       -V--Y--L--K--T--I--K--H--E--L--L--K--S--V--N--D--I--V--V--L-
541    TGGACCAGAACAGTTCTATGCCACCAGAGACCACTATTTTACCAACTCCCTCCTGTCATT    600
       -G--P--E--Q--F--Y--A--T--R--D--H--Y--F--T--N--S--L--L--S--F-
601    TTTTGAGATGATCTTGGATCTTCGCTGGACTTATGTTCTTTTCTACAGCCCAAGGGAGGT    660
       -F--E--M--I--L--D--L--R--W--T--Y--V--L--F--Y--S--P--R--E--V-
661    TAAAGTGGTGGCCAAAGGATTTTGTAGTGCCAATGGGATCACAGTCTCAGCAGACCAGAA    720
       -K--V--V--A--K--G--F--C--S--A--N--G--I--T--V--S--A--D--Q--K-
721    GTATGTCTATGTAGCTGATGTAGCAGCTAAGAACATTCACATAATGGAAAAACATGATAA    780
       -Y--V--Y--V--A--D--V--A--A--K--N--I--H--I--M--E--K--H--D--N-
781    CTGGGATTTAACTCAACTGAAGGTGATACAGTTGGGCACCTTAGTGGATAACCTGACTGT    840
       -W--D--L--T--Q--L--K--V--I--Q--L--G--T--L--V--D--N--L--T--V-
841    CGATCCTGCCACAGGAGACATTTTGGCAGGATGCCATCCTAATCCTATGAAGCTACTGAA    900
       -D--P--A--T--G--D--I--L--A--G--C--H--P--N--P--M--K--L--L--N-
901    CTATAACCCTGAGGACCCTCCAGGATCAGAAGTACTTCGCATCCAGAATGTTTTGTCTGA    960
       -Y--N--P--E--D--P--P--G--S--E--V--L--R--I--Q--N--V--L--S--E-
961    GAAGCCCAGGGTGAGCACCGTGTATGCCAACAATGGCTCTGTGCTTCAGGGCACCTCTGT   1020
       -K--P--R--V--S--T--V--Y--A--N--N--G--S--V--L--Q--G--T--S--V-
1021   GGCTTCTGTGTACCATGGGAAAATTCTCATAGGCACCGTATTTCACAAAACTCTGTACTG   1080
       -A--S--V--Y--H--G--K--I--L--I--G--T--V--F--H--K--T--L--Y--C-
1081   TGAGCTCTAGactctagatagtaaaaaaaaaaaaaaaaagtctacatattttgtaaaagt   1140
       -E--L--***..................................................
1141   aaactgataattgtatgataagtggcactgtaagtaaatagcaaacaccaaaaaaaaaaa   1200
       ............................................................
1201   a                                                              1260
       .