Imprinted Gene Databases

Homo sapiens: PLAGL1

Pleiomorphic adenoma gene-like 1
Species Gene Aliases Location Status Expressed Allele
Sus scrofa PLAGL1   Imprinted Paternal
Mus musculus Plagl1 Lot1, Zac1  10 15.0 cM  Imprinted Paternal
Bos taurus PLAGL1 ZAC1  Imprinted Paternal
Macaca mulatta PLAGL1   Imprinted Paternal
Homo sapiens PLAGL1 ZAC, LOT1, ZAC1, MGC126275, MGC126276, DKFZp781P1017  6q24-q25  Imprinted Paternal
Monodelphis domestica PLAGL1     Not Imprinted Biallelic
1      gagccccgcctgcgcgcggcctcctcggcgcagccatcctcttggctgccgcgggcggca     60
61     aagcccacggcatctgccatttgtcattcagcccgtcggtaccgccccgagccttgattt    120
121    agacacggctggggcgtgctctggcctcactctccgggcgggtgctggacggacggacgg    180
181    acggggcagccgtgctcacagctcagcagcgcggggccttggcgcgcggggcgcttcccc    240
241    gggtcgccgtcatggccgcggaggtggcacgcccgagcggcctcgcctgagctccggggg    300
301    tcgtcgccccgcagggattgctgtcacgtctaatgtggctgctgcctcgtgtcacatctg    360
361    aaactcatctgtacctcacttagaaagtggttctgattagacaagacttttcgttgcagt    420
421    cgacagaaacctaatgggaccattgaagaattccaaacaggtatttgcataggaatcaga    480
481    ggagttaatcttgtttgaatcttcagacaaacttctgggaggactcggtccctgcctcgc    540
541    agcagatgttccctgtcactcagtagccaatccgggggacccaggacatgccccagctat    600
601    agtgatgcagattacctttctgctcctgaatcgcacctgtgcctcagactttctcccctc    660
661    agcttgagactgcatgtaaactgggatgtgtgaaagcaggaagcaaagctagtgacagct    720
721    gagaggtccatgtctgggtagaaccaggcccacgatgctgcctctcccgtggtctggagt    780
781    tcagctgcagggactctgctgatgtgcccagcaccatcgttctgtttgtgcttaaatggc    840
841    acagcatttggtcagcacatctgaaaaggaaggtgtgagaagcaaagcccATGGCCACGT    900
2281   AAttgatttttaaagtgtatttttcgtattctggaagatgttttaagaagcattttaaat   2340
2341   gtcagttacaatatgagaaagatttggaaaacgagactgggactatggcttattcagtga   2400
2401   tgactggcttgagatgataagagaattctcgaactgcatgtattgtgccaatctgtcctg   2460
2461   agtgttcatgctttgtaccaaatttaatgaacgcgtgttctgtaatcaaactgcaaatat   2520
2521   tgtcataaccaacatccaaaatgacggctgctatatataagtgtttgtcatatggaattt   2580
2581   aatcgtaagccatgatcataatgttaactaaataactttatgtggcactgcctagtaagg   2640
2641   gaactatggaaaggtttggatttctccaaatctgggagaattttcaaaataagaaaataa   2700
2701   cctttatatgatatactatgactaggctgtgtatttcttttcagggatttttctaccttc   2760
2761   agggttggatgtagtttagttactattaccatagccaacctgtagttttacatatacatt   2820
2821   ttcttgtggagcaatagagttctccattttacagaagcattttaaatgtagtttgaatat   2880
2881   tttccacaagatgctgcaatgtgagttatcacttcatttatcttaaagaaagactaaact   2940
2941   ggttgtcagttacatctgacagaaaaaaaaaaaaaatcactgtgtaaccaggttaagtgg   3000
3001   taaaataatccaggcgtcagtcaaaggcattttgctgactttaatattgattatattttt   3060
3061   aacaggaatttaagaaaatattactggaattaaaaatatatatatattaaacaagaattt   3120
3121   tctttgctctgtctagcttaaactactactcaagctgcttaagttcttaagtattgtttg   3180
3181   taatcaccaataaataagtgcatttgtaattcatcagtcattattagcttttattaaaag   3240
3241   aagattacgttttacaatgtaactataatctcttgaatttggtatcttattaatgagttt   3300
3301   taaagatgtaaaacctaaccttttttaaagctccattgtcttatgtttttagaggctttt   3360
3361   ccgtaaacatatatcttacatataataaacttttcaaatcttgcaaaaaaa            3420