Imprinted Gene Databases

Homo sapiens: PLAGL1

Pleiomorphic adenoma gene-like 1
Species Gene Aliases Location Status Expressed Allele
Homo sapiens PLAGL1 ZAC, LOT1, ZAC1, MGC126275, MGC126276, DKFZp781P1017  6q24-q25  Imprinted Paternal
Mus musculus Plagl1 Lot1, Zac1  10 15.0 cM  Imprinted Paternal
Monodelphis domestica PLAGL1     Not Imprinted Biallelic
Bos taurus PLAGL1 ZAC1  Imprinted Paternal
Macaca mulatta PLAGL1   Imprinted Paternal
Sus scrofa PLAGL1   Imprinted Paternal
1      gagccccgcctgcgcgcggcctcctcggcgcagccatcctcttggctgccgcgggcggca     60
       ............................................................
61     aagcccacggcatctgccatttgtcattcagcccgtcggtaccgccccgagccttgattt    120
       ............................................................
121    agacacggctggggcgtgctctggcctcactctccgggcgggtgctggacggacggacgg    180
       ............................................................
181    acggggcagccgtgctcacagctcagcagcgcggggccttggcgcgcggggcgcttcccc    240
       ............................................................
241    gggtcgccgtcatggccgcggaggtggcacgcccgagcggcctcgcctgagctccggggg    300
       ............................................................
301    tcgtcgccccgcagggattgctgtcacgtctaatgtggctgctgcctcgtgtcacatctg    360
       ............................................................
361    aaactcatctgtacctcacttagaaagtggttctgattagacaagacttttcgttgcagt    420
       ............................................................
421    cgacagaaacctaatgggaccattgaagaattccaaacaggtatttgcataggaatcaga    480
       ............................................................
481    ggagttaatcttgtttgaatcttcagacaaacttctgggaggactcggtccctgcctcgc    540
       ............................................................
541    agcagatgttccctgtcactcagtagccaatccgggggacccaggacatgccccagctat    600
       ............................................................
601    agtgatgcagattacctttctgctcctgaatcgcacctgtgcctcagactttctcccctc    660
       ............................................................
661    agcttgagactgcatgtaaactgggatgtgtgaaagcaggaagcaaagctagtgacagct    720
       ............................................................
721    gagaggtccatgtctgggtagaaccaggcccacgatgctgcctctcccgtggtctggagt    780
       ............................................................
781    tcagctgcagggactctgctgatgtgcccagcaccatcgttctgtttgtgcttaaatggc    840
       ............................................................
841    acagcatttggtcagcacatctgaaaaggaaggtgtgagaagcaaagcccATGGCCACGT    900
       ..................................................M--A--T--F
901    TCCCCTGCCAGTTATGTGGCAAGACGTTCCTCACCCTGGAGAAGTTCACGATTCACAATT    960
       --P--C--Q--L--C--G--K--T--F--L--T--L--E--K--F--T--I--H--N--Y
961    ATTCCCACTCCAGGGAGCGGCCGTACAAGTGTGTGCAGCCTGACTGTGGCAAAGCCTTTG   1020
       --S--H--S--R--E--R--P--Y--K--C--V--Q--P--D--C--G--K--A--F--V
1021   TTTCCAGATATAAATTGATGAGGCATATGGCTACCCATTCTCCCCAGAAATCTCACCAGT   1080
       --S--R--Y--K--L--M--R--H--M--A--T--H--S--P--Q--K--S--H--Q--C
1081   GTGCTCACTGTGAGAAGACGTTCAACCGGAAAGACCACCTGAAAAACCACCTCCAGACCC   1140
       --A--H--C--E--K--T--F--N--R--K--D--H--L--K--N--H--L--Q--T--H
1141   ACGACCCCAACAAAATGGCCTTTGGGTGTGAGGAGTGTGGGAAGAAGTACAACACCATGC   1200
       --D--P--N--K--M--A--F--G--C--E--E--C--G--K--K--Y--N--T--M--L
1201   TGGGCTATAAGAGGCACCTGGCCCTCCATGCGGCCAGCAGTGGGGACCTCACCTGTGGGG   1260
       --G--Y--K--R--H--L--A--L--H--A--A--S--S--G--D--L--T--C--G--V
1261   TCTGTGCCCTGGAGCTAGGGAGCACCGAGGTGCTACTGGACCACCTCAAAGCCCATGCGG   1320
       --C--A--L--E--L--G--S--T--E--V--L--L--D--H--L--K--A--H--A--E
1321   AAGAGAAGCCCCCTAGCGGAACCAAGGAAAAGAAGCACCAGTGCGACCACTGTGAAAGAT   1380
       --E--K--P--P--S--G--T--K--E--K--K--H--Q--C--D--H--C--E--R--C
1381   GCTTCTACACCCGGAAGGATGTGCGACGCCACCTGGTGGTCCACACAGGATGCAAGGACT   1440
       --F--Y--T--R--K--D--V--R--R--H--L--V--V--H--T--G--C--K--D--F
1441   TCCTGTGCCAGTTCTGTGCCCAGAGATTTGGGCGCAAGGATCACCTCACCCGGCATACCA   1500
       --L--C--Q--F--C--A--Q--R--F--G--R--K--D--H--L--T--R--H--T--K
1501   AGAAGACCCACTCACAGGAGCTGATGAAAGAGAGCTTGCAGACCGGAGACCTTCTGAGCA   1560
       --K--T--H--S--Q--E--L--M--K--E--S--L--Q--T--G--D--L--L--S--T
1561   CCTTCCACACCATCTCGCCTTCATTCCAACTGAAGGCTGCTGCCTTGCCTCCTTTCCCTT   1620
       --F--H--T--I--S--P--S--F--Q--L--K--A--A--A--L--P--P--F--P--L
1621   TAGGAGCTTCTGCCCAGAACGGGCTTGCAAGTAGCTTGCCAGCTGAGGTCCATAGCCTCA   1680
       --G--A--S--A--Q--N--G--L--A--S--S--L--P--A--E--V--H--S--L--T
1681   CCCTCAGTCCCCCAGAACAAGCCGCCCAGCCTATGCAGCCGCTGCCAGAGTCCCTGGCCT   1740
       --L--S--P--P--E--Q--A--A--Q--P--M--Q--P--L--P--E--S--L--A--S
1741   CCCTCCACCCCTCGGTATCCCCTGGCTCTCCTCCGCCACCCCTTCCCAATCACAAGTACA   1800
       --L--H--P--S--V--S--P--G--S--P--P--P--P--L--P--N--H--K--Y--N
1801   ACACCACTTCTACCTCATACTCCCCACTTGCAAGCCTGCCCCTCAAAGCAGATACTAAAG   1860
       --T--T--S--T--S--Y--S--P--L--A--S--L--P--L--K--A--D--T--K--G
1861   GTTTTTGCAATATCAGTTTGTTTGAGGACTTGCCTCTGCAAGAGCCTCAGTCACCTCAAA   1920
       --F--C--N--I--S--L--F--E--D--L--P--L--Q--E--P--Q--S--P--Q--K
1921   AGCTCAACCCAGGTTTTGATCTGGCTAAGGGAAATGCTGGTAAAGTAAACCTGCCCAAGG   1980
       --L--N--P--G--F--D--L--A--K--G--N--A--G--K--V--N--L--P--K--E
1981   AGCTGCCTGCAGATGCTGTGAACCTAACAATACCTGCCTCTCTGGACCTGTCCCCCCTGT   2040
       --L--P--A--D--A--V--N--L--T--I--P--A--S--L--D--L--S--P--L--L
2041   TGGGCTTCTGGCAGCTGCCCCCTCCTGCTACCCAAAATACCTTTGGGAATAGCACTCTTG   2100
       --G--F--W--Q--L--P--P--P--A--T--Q--N--T--F--G--N--S--T--L--A
2101   CCCTGGGGCCTGGGGAATCTTTGCCCCACAGGTTAAGCTGTCTGGGGCAGCAGCAGCAAG   2160
       --L--G--P--G--E--S--L--P--H--R--L--S--C--L--G--Q--Q--Q--Q--E
2161   AACCCCCACTTGCCATGGGCACTGTGAGCCTGGGCCAGCTCCCCCTGCCCCCCATCCCTC   2220
       --P--P--L--A--M--G--T--V--S--L--G--Q--L--P--L--P--P--I--P--H
2221   ATGTGTTCTCAGCTGGCACTGGCTCTGCCATCCTGCCTCATTTCCATCATGCATTCAGAT   2280
       --V--F--S--A--G--T--G--S--A--I--L--P--H--F--H--H--A--F--R--*
2281   AAttgatttttaaagtgtatttttcgtattctggaagatgttttaagaagcattttaaat   2340
       **..........................................................
2341   gtcagttacaatatgagaaagatttggaaaacgagactgggactatggcttattcagtga   2400
       ............................................................
2401   tgactggcttgagatgataagagaattctcgaactgcatgtattgtgccaatctgtcctg   2460
       ............................................................
2461   agtgttcatgctttgtaccaaatttaatgaacgcgtgttctgtaatcaaactgcaaatat   2520
       ............................................................
2521   tgtcataaccaacatccaaaatgacggctgctatatataagtgtttgtcatatggaattt   2580
       ............................................................
2581   aatcgtaagccatgatcataatgttaactaaataactttatgtggcactgcctagtaagg   2640
       ............................................................
2641   gaactatggaaaggtttggatttctccaaatctgggagaattttcaaaataagaaaataa   2700
       ............................................................
2701   cctttatatgatatactatgactaggctgtgtatttcttttcagggatttttctaccttc   2760
       ............................................................
2761   agggttggatgtagtttagttactattaccatagccaacctgtagttttacatatacatt   2820
       ............................................................
2821   ttcttgtggagcaatagagttctccattttacagaagcattttaaatgtagtttgaatat   2880
       ............................................................
2881   tttccacaagatgctgcaatgtgagttatcacttcatttatcttaaagaaagactaaact   2940
       ............................................................
2941   ggttgtcagttacatctgacagaaaaaaaaaaaaaatcactgtgtaaccaggttaagtgg   3000
       ............................................................
3001   taaaataatccaggcgtcagtcaaaggcattttgctgactttaatattgattatattttt   3060
       ............................................................
3061   aacaggaatttaagaaaatattactggaattaaaaatatatatatattaaacaagaattt   3120
       ............................................................
3121   tctttgctctgtctagcttaaactactactcaagctgcttaagttcttaagtattgtttg   3180
       ............................................................
3181   taatcaccaataaataagtgcatttgtaattcatcagtcattattagcttttattaaaag   3240
       ............................................................
3241   aagattacgttttacaatgtaactataatctcttgaatttggtatcttattaatgagttt   3300
       ............................................................
3301   taaagatgtaaaacctaaccttttttaaagctccattgtcttatgtttttagaggctttt   3360
       ............................................................
3361   ccgtaaacatatatcttacatataataaacttttcaaatcttgcaaaaaaa            3420
       ...................................................