Imprinted Gene Databases

Homo sapiens: PHLDA2

Pleckstrin homology-like domain, family A, member 2
Species Gene Aliases Location Status Expressed Allele
Sus scrofa PHLDA2 IPL  Imprinted Maternal
Homo sapiens PHLDA2 IPL, BRW1C, BWR1C, HLDA2, TSSC3  11p15.5  Imprinted Maternal
Bos taurus PHLDA2   29  Imprinted Maternal
Mus musculus Phlda2 Ipl, Tssc3  7 69.5 cM  Imprinted Maternal
1      agagccggcgccgtcaccgcccgcattgccgctcccagtcccgcgctcggcacgacATGA     60
       ........................................................M--K
61     AATCCCCCGACGAGGTGCTACGCGAGGGCGAGTTGGAGAAGCGCAGCGACAGCCTCTTCC    120
       --S--P--D--E--V--L--R--E--G--E--L--E--K--R--S--D--S--L--F--Q
121    AGCTATGGAAGAAGAAGCGCGGGGTGCTCACCTCCGACCGCCTGAGCCTGTTCCCCGCCA    180
       --L--W--K--K--K--R--G--V--L--T--S--D--R--L--S--L--F--P--A--S
181    GCCCCCGCGCGCGCCCCAAGGAGCTGCGCTTCCACTCCATCCTCAAGGTGGACTGCGTGG    240
       --P--R--A--R--P--K--E--L--R--F--H--S--I--L--K--V--D--C--V--E
241    AGCGCACGGGCAAGTACGTGTACTTCACCATCGTCACCACCGACCACAAGGAGATCGACT    300
       --R--T--G--K--Y--V--Y--F--T--I--V--T--T--D--H--K--E--I--D--F
301    TCCGCTGCGCGGGCGAGAGCTGCTGGAACGCGGCCATCGCGCTGGCGCTCATCGATTTCC    360
       --R--C--A--G--E--S--C--W--N--A--A--I--A--L--A--L--I--D--F--Q
361    AGAACCGCCGCGCCCTGCAGGACTTTCGCAGCCGCCAGGAACGCACCGCACCCGCCGCAC    420
       --N--R--R--A--L--Q--D--F--R--S--R--Q--E--R--T--A--P--A--A--P
421    CCGCCGAGGACGCCGTGGCTGCCGCGGCCGCCGCACCCTCCGAGCCCTCGGAGCCCTCCA    480
       --A--E--D--A--V--A--A--A--A--A--A--P--S--E--P--S--E--P--S--R
481    GGCCATCCCCGCAGCCCAAACCCCGCACGCCATGAgcccgccgcgggccatacgctggac    540
       --P--S--P--Q--P--K--P--R--T--P--***.........................
541    gagtcggaccgaggctaggacgtggccggcgctctccagccctgcagcagaagaacttcc    600
       ............................................................
601    cgtgcgcgcggatcctcgctccgttgcacgggcgccttaagttattggactatctaatat    660
       ............................................................
661    ctatgtatttatttcgctggttctttgtagtcacatattttatagtcttaatatcttgtt    720
       ............................................................
721    tttgcatcactgtgcccattgcaaataaatcacttggccagtttgcttttctaccatccg    780
       ............................................................
781    gctgtggctcagtgagactcctgctgggagggtggaggcccaggaatgggcgggcaggac    840
       ............................................................
841    accctcatccagtcctgcggggctggtgtgaaaggcgctgggaaccggctttgaatgaat    900
       ............................................................
901    aaatgaatcgtgtcatctgcaaaaaaaaaaaaaaaaa                           960
       .....................................