Imprinted Gene Databases

Homo sapiens: PHLDA2

Pleckstrin homology-like domain, family A, member 2
Species Gene Aliases Location Status Expressed Allele
Homo sapiens PHLDA2 IPL, BRW1C, BWR1C, HLDA2, TSSC3  11p15.5  Imprinted Maternal
Sus scrofa PHLDA2 IPL  Imprinted Maternal
Mus musculus Phlda2 Ipl, Tssc3  7 69.5 cM  Imprinted Maternal
Bos taurus PHLDA2   29  Imprinted Maternal
1      agagccggcgccgtcaccgcccgcattgccgctcccagtcccgcgctcggcacgacATGA     60
       ........................................................M--K
61     AATCCCCCGACGAGGTGCTACGCGAGGGCGAGTTGGAGAAGCGCAGCGACAGCCTCTTCC    120
       --S--P--D--E--V--L--R--E--G--E--L--E--K--R--S--D--S--L--F--Q
121    AGCTATGGAAGAAGAAGCGCGGGGTGCTCACCTCCGACCGCCTGAGCCTGTTCCCCGCCA    180
       --L--W--K--K--K--R--G--V--L--T--S--D--R--L--S--L--F--P--A--S
181    GCCCCCGCGCGCGCCCCAAGGAGCTGCGCTTCCACTCCATCCTCAAGGTGGACTGCGTGG    240
       --P--R--A--R--P--K--E--L--R--F--H--S--I--L--K--V--D--C--V--E
241    AGCGCACGGGCAAGTACGTGTACTTCACCATCGTCACCACCGACCACAAGGAGATCGACT    300
       --R--T--G--K--Y--V--Y--F--T--I--V--T--T--D--H--K--E--I--D--F
301    TCCGCTGCGCGGGCGAGAGCTGCTGGAACGCGGCCATCGCGCTGGCGCTCATCGATTTCC    360
       --R--C--A--G--E--S--C--W--N--A--A--I--A--L--A--L--I--D--F--Q
361    AGAACCGCCGCGCCCTGCAGGACTTTCGCAGCCGCCAGGAACGCACCGCACCCGCCGCAC    420
       --N--R--R--A--L--Q--D--F--R--S--R--Q--E--R--T--A--P--A--A--P
421    CCGCCGAGGACGCCGTGGCTGCCGCGGCCGCCGCACCCTCCGAGCCCTCGGAGCCCTCCA    480
       --A--E--D--A--V--A--A--A--A--A--A--P--S--E--P--S--E--P--S--R
481    GGCCATCCCCGCAGCCCAAACCCCGCACGCCATGAgcccgccgcgggccatacgctggac    540
       --P--S--P--Q--P--K--P--R--T--P--***.........................
541    gagtcggaccgaggctaggacgtggccggcgctctccagccctgcagcagaagaacttcc    600
       ............................................................
601    cgtgcgcgcggatcctcgctccgttgcacgggcgccttaagttattggactatctaatat    660
       ............................................................
661    ctatgtatttatttcgctggttctttgtagtcacatattttatagtcttaatatcttgtt    720
       ............................................................
721    tttgcatcactgtgcccattgcaaataaatcacttggccagtttgcttttctaccatccg    780
       ............................................................
781    gctgtggctcagtgagactcctgctgggagggtggaggcccaggaatgggcgggcaggac    840
       ............................................................
841    accctcatccagtcctgcggggctggtgtgaaaggcgctgggaaccggctttgaatgaat    900
       ............................................................
901    aaatgaatcgtgtcatctgcaaaaaaaaaaaaaaaaa                           960
       .....................................