Imprinted Gene Databases

Homo sapiens: OSBPL5

Oxysterol binding protein-like 5
Species Gene Aliases Location Status Expressed Allele
Mus musculus Osbpl5 ORP5, Obph1, Osbp2, AI462538, 1110006M06Rik  7 69.59 cM  Conflicting Data Unknown
Homo sapiens OSBPL5 ORP5, OBPH1, FLJ42929  11p15.4  Imprinted Maternal
Bos taurus OSBPL5   29  Not Imprinted Biallelic
1      ctccctccgccgcgccctcgctccgcctcgcgcggggggaccatctgctggcatttcctg     60
       ............................................................
61     cagccaggcccgcgccgccagtggagcccccgcgcgcccggccggcccggagcaccgagc    120
       ............................................................
121    tcgcggcacggtaggagaagcccccgagcgcccacagcATGAAGGAGGAGGCCTTCCTCC    180
       ......................................M--K--E--E--A--F--L--R
181    GGCGCCGCTTCTCCCTGTGTCCACCTTCCTCCACCCCTCAGAAAGTCGACCCCCGGAAGC    240
       --R--R--F--S--L--C--P--P--S--S--T--P--Q--K--V--D--P--R--K--L
241    TCACCCGGAACTTGCTCCTCAGCGGAGACAATGAGCTCTACCCACTCAGCCCAGGGAAGG    300
       --T--R--N--L--L--L--S--G--D--N--E--L--Y--P--L--S--P--G--K--D
301    ACATGGAGCCCAACGGCCCGTCGCTGCCCAGGGATGAAGGGCCCCCGACCCCAAGCTCTG    360
       --M--E--P--N--G--P--S--L--P--R--D--E--G--P--P--T--P--S--S--A
361    CCACGAAGGTGCCACCGGCAGAGTACAGGCTGTGCAACGGGTCAGACAAGGAATGTGTGT    420
       --T--K--V--P--P--A--E--Y--R--L--C--N--G--S--D--K--E--C--V--S
421    CCCCCACCGCCAGGGTCACCAAGAAGGAGACTCTCAAGGCGCAGAAGGAGAACTACCGGC    480
       --P--T--A--R--V--T--K--K--E--T--L--K--A--Q--K--E--N--Y--R--Q
481    AGGAGAAGAAGCGCGCCACACGGCAGCTGCTCAGCGCTCTGACAGACCCCAGCGTGGTCA    540
       --E--K--K--R--A--T--R--Q--L--L--S--A--L--T--D--P--S--V--V--I
541    TCATGGCTGACAGCCTGAAGATCCGCGGCACCCTGAAGAGCTGGACCAAGCTGTGGTGCG    600
       --M--A--D--S--L--K--I--R--G--T--L--K--S--W--T--K--L--W--C--V
601    TGCTGAAGCCGGGGGTGCTGCTCATCTACAAGACGCCCAAGGTGGGCCAGTGGGTGGGCA    660
       --L--K--P--G--V--L--L--I--Y--K--T--P--K--V--G--Q--W--V--G--T
661    CGGTGCTGCTGCACTGCTGCGAGCTCATCGAGCGGCCCTCCAAGAAGGACGGCTTCTGCT    720
       --V--L--L--H--C--C--E--L--I--E--R--P--S--K--K--D--G--F--C--F
721    TCAAGCTCTTCCACCCGCTGGATCAGTCCGTCTGGGCCGTGAAGGGCCCCAAAGGTGAGA    780
       --K--L--F--H--P--L--D--Q--S--V--W--A--V--K--G--P--K--G--E--S
781    GCGTGGGCTCCATCACACAGCCCCTGCCCAGCAGCTACCTGATCTTCAGGGCCGCCTCCG    840
       --V--G--S--I--T--Q--P--L--P--S--S--Y--L--I--F--R--A--A--S--E
841    AGTCAGATGGTCGCTGCTGGCTGGACGCCCTGGAGCTGGCCCTGCGCTGCTCTAGCCTAC    900
       --S--D--G--R--C--W--L--D--A--L--E--L--A--L--R--C--S--S--L--L
901    TGAGACTGGGCACCTGCAAGCCGGGCCGAGACGGGGAGCCAGGGACCTCGCCAGACGCAT    960
       --R--L--G--T--C--K--P--G--R--D--G--E--P--G--T--S--P--D--A--S
961    CACCCTCATCGCTCTGTGGGCTGCCAGCCTCAGCCACCGTCCACCCAGACCAAGACCTGT   1020
       --P--S--S--L--C--G--L--P--A--S--A--T--V--H--P--D--Q--D--L--F
1021   TCCCACTGAACGGGTCTTCCCTGGAGAACGATGCATTCTCAGACAAGTCGGAGAGAGAGA   1080
       --P--L--N--G--S--S--L--E--N--D--A--F--S--D--K--S--E--R--E--N
1081   ACCCTGAGGAGTCAGATACCGAGACCCAGGACCATAGCCGGAAGACGGAGAGTGGCAGCG   1140
       --P--E--E--S--D--T--E--T--Q--D--H--S--R--K--T--E--S--G--S--D
1141   ACCAGTCAGAGACCCCTGGGGCCCCGGTGCGGAGAGGGACCACCTATGTGGAGCAGGTCC   1200
       --Q--S--E--T--P--G--A--P--V--R--R--G--T--T--Y--V--E--Q--V--Q
1201   AGGAGGAGCTGGGGGAGCTGGGCGAGGCGTCCCAGGTGGAGACAGTGTCAGAGGAGAACA   1260
       --E--E--L--G--E--L--G--E--A--S--Q--V--E--T--V--S--E--E--N--K
1261   AGAGTCTGATGTGGACCCTGCTGAAGCAGCTACGGCCAGGCATGGACCTGTCCCGCGTGG   1320
       --S--L--M--W--T--L--L--K--Q--L--R--P--G--M--D--L--S--R--V--V
1321   TGCTACCCACGTTCGTACTGGAGCCGCGCTCCTTCCTGAACAAGCTCTCCGACTACTACT   1380
       --L--P--T--F--V--L--E--P--R--S--F--L--N--K--L--S--D--Y--Y--Y
1381   ACCACGCAGACCTGCTCTCCAGGGCTGCGGTGGAGGAGGATGCCTACAGCCGCATGAAGC   1440
       --H--A--D--L--L--S--R--A--A--V--E--E--D--A--Y--S--R--M--K--L
1441   TGGTGCTGCGGTGGTACCTGTCTGGCTTCTACAAGAAGCCCAAGGGAATCAAGAAGCCGT   1500
       --V--L--R--W--Y--L--S--G--F--Y--K--K--P--K--G--I--K--K--P--Y
1501   ACAACCCCATCCTGGGGGAGACCTTCCGCTGCTGCTGGTTCCACCCGCAGACTGACAGCC   1560
       --N--P--I--L--G--E--T--F--R--C--C--W--F--H--P--Q--T--D--S--R
1561   GCACATTCTACATAGCAGAGCAGGTGTCCCACCACCCGCCCGTGTCTGCCTTCCACGTCA   1620
       --T--F--Y--I--A--E--Q--V--S--H--H--P--P--V--S--A--F--H--V--S
1621   GCAACCGGAAGGACGGCTTCTGCATCAGTGGCAGCATCACAGCCAAGTCCAGGTTTTATG   1680
       --N--R--K--D--G--F--C--I--S--G--S--I--T--A--K--S--R--F--Y--G
1681   GGAACTCGCTGTCGGCGCTGCTGGACGGCAAAGCCACGCTCACCTTCCTGAACCGAGCCG   1740
       --N--S--L--S--A--L--L--D--G--K--A--T--L--T--F--L--N--R--A--E
1741   AGGATTACACCCTTACCATGCCCTACGCCCACTGCAAAGGAATCCTGTATGGCACGATGA   1800
       --D--Y--T--L--T--M--P--Y--A--H--C--K--G--I--L--Y--G--T--M--T
1801   CCCTGGAGCTGGGTGGGAAGGTCACCATCGAGTGTGCGAAGAACAACTTCCAGGCCCAGC   1860
       --L--E--L--G--G--K--V--T--I--E--C--A--K--N--N--F--Q--A--Q--L
1861   TGGAATTCAAACTCAAGCCCTTCTTCGGGGGTAGCACCAGCATCAACCAGATCTCGGGAA   1920
       --E--F--K--L--K--P--F--F--G--G--S--T--S--I--N--Q--I--S--G--K
1921   AGATCACGTCGGGAGAGGAAGTCCTGGCGAGCCTCAGTGGCCACTGGGACAGGGACGTGT   1980
       --I--T--S--G--E--E--V--L--A--S--L--S--G--H--W--D--R--D--V--F
1981   TTATCAAGGAGGAAGGGAGCGGAAGCAGTGCGCTTTTCTGGACCCCGAGCGGGGAGGTCC   2040
       --I--K--E--E--G--S--G--S--S--A--L--F--W--T--P--S--G--E--V--R
2041   GCAGACAGAGGCTGAGGCAGCACACGGTGCCGCTGGAGGAGCAGACGGAGCTGGAGTCCG   2100
       --R--Q--R--L--R--Q--H--T--V--P--L--E--E--Q--T--E--L--E--S--E
2101   AGAGGCTCTGGCAGCACGTCACCAGGGCCATCAGCAAGGGCGACCAGCACAGGGCCACAC   2160
       --R--L--W--Q--H--V--T--R--A--I--S--K--G--D--Q--H--R--A--T--Q
2161   AGGAGAAGTTTGCACTGGAGGAGGCACAGCGGCAGCGGGCCCGTGAGCGGCAGGAGAGCC   2220
       --E--K--F--A--L--E--E--A--Q--R--Q--R--A--R--E--R--Q--E--S--L
2221   TCATGCCCTGGAAGCCGCAGCTGTTCCACCTGGACCCCATCACCCAGGAGTGGCACTACC   2280
       --M--P--W--K--P--Q--L--F--H--L--D--P--I--T--Q--E--W--H--Y--R
2281   GATACGAGGACCACAGCCCCTGGGACCCCCTGAAGGACATCGCCCAGTTTGAGCAAGACG   2340
       --Y--E--D--H--S--P--W--D--P--L--K--D--I--A--Q--F--E--Q--D--G
2341   GGATCCTGCGGACCTTGCAGCAGGAGGCCGTGGCCCGCCAGACCACCTTCCTGGGCAGCC   2400
       --I--L--R--T--L--Q--Q--E--A--V--A--R--Q--T--T--F--L--G--S--P
2401   CAGGGCCCAGGCACGAGAGGTCTGGCCCAGACCAGCGGCTTCGCAAGGCCAGCGACCAGC   2460
       --G--P--R--H--E--R--S--G--P--D--Q--R--L--R--K--A--S--D--Q--P
2461   CCTCCGGCCACAGCCAGGCCACGGAGAGCAGCGGATCCACGCCTGAGTCCTGCCCAGAGC   2520
       --S--G--H--S--Q--A--T--E--S--S--G--S--T--P--E--S--C--P--E--L
2521   TCTCAGACGAGGAGCAGGATGGTGACTTTGTCCCTGGCGGTGAGAGCCCATGCCCTCGGT   2580
       --S--D--E--E--Q--D--G--D--F--V--P--G--G--E--S--P--C--P--R--C
2581   GCAGGAAGGAGGCGCGGCGGCTGCAGGCCCTGCACGAGGCCATCCTCTCCATCCGAGAGG   2640
       --R--K--E--A--R--R--L--Q--A--L--H--E--A--I--L--S--I--R--E--A
2641   CCCAGCAGGAGCTGCACAGGCACCTCTCGGCCATGCTGAGCTCCACGGCACGGGCAGCAC   2700
       --Q--Q--E--L--H--R--H--L--S--A--M--L--S--S--T--A--R--A--A--Q
2701   AGGCACCGACCCCAGGCCTCCTGCAGAGCCCCCGATCCTGGTTCCTGCTCTGCGTGTTCC   2760
       --A--P--T--P--G--L--L--Q--S--P--R--S--W--F--L--L--C--V--F--L
2761   TGGCGTGTCAGCTGTTCATTAACCACATCCTCAAATAGgagccctgagggcagagctcct   2820
       --A--C--Q--L--F--I--N--H--I--L--K--***......................
2821   ggccggtcctgagccctccctcccaggcacccagcactttaagcctgctccatggaggca   2880
       ............................................................
2881   gagaggcccggcaagcacagccactgtgacggggagtccaggcgcaggagggacccgggg   2940
       ............................................................
2941   ccacaaggcgctgcgggcccaggtgtgctgggcccctctcaggggcactggcctctctgc   3000
       ............................................................
3001   agggccttccgcccagcgctggccttaatgctaaagccaaatgcagcttctgctgtgcga   3060
       ............................................................
3061   cgcactcctggccatcttgccgtgtcaccccctgtccggcctccacttgccatgggggat   3120
       ............................................................
3121   ggatggatttagggtgggagggcctgtgggggccctggacagtcacaccccagcagcagt   3180
       ............................................................
3181   gagtgggcaggtttggaggagccccgagtggcccaggagtccccccacacacagatgcat   3240
       ............................................................
3241   aggcctgccttccggagaccctgtccacattgccgggaccaccctggtggggccactggt   3300
       ............................................................
3301   gggtgccagggacaggttagggccactctggggaaggcattttggttttttattccacgc   3360
       ............................................................
3361   tgtgctgtttggatgggagccccacagaggcaggtcctggaaccaccccacccccacacc   3420
       ............................................................
3421   tggacgctcgctctggtgggggcacacgcaggtggaggtggttgtgggtgcaggtgtgtg   3480
       ............................................................
3481   caggggtgtggggggcgcaggggtgtggcttagctggccccgcacccaggccggggaggc   3540
       ............................................................
3541   tcaagttcgccactttactcagaccgatgcacagtcttcccattttacacttttttaata   3600
       ............................................................
3601   aacataattgcaatattttaggtgggctgcgagctgcagtcagccttcacgtctggcctc   3660
       ............................................................
3661   agtccccgtgtcagtgccgctctgcgtgtgcgtgtgcgcgtgtgtgagcctctacacata   3720
       ............................................................
3721   tatatacgtacagagccttaaaccacatcgtggcggtgccgtctgagctgtagcgggtgg   3780
       ............................................................
3781   ctttgtttccagtttttgtacccgtgtccttgtctcccctcctcccccatctggggatgt   3840
       ............................................................
3841   gtctgtgttccacaccttgaaataaacagacacatacgtgttctcttaaaaaaaaaaaaa   3900
       ............................................................
3901   aaaa                                                           3960
       ....