Imprinted Gene Databases

Homo sapiens: NNAT

Neuronatin

Evans et al., Genomics 77: 99-104, 2001

Species Gene Aliases Location Status Expressed Allele
Mus musculus Nnat Peg5, AW107673, 5730414I02Rik  2 88.0 cM  Imprinted Paternal
Sus scrofa NNAT   17  Imprinted Paternal
Bos taurus NNAT   13  Imprinted Paternal
Homo sapiens NNAT Peg5  20q11.2-q12  Imprinted Paternal
1      taggtggcgggcgggtacttaaggcgcggccaccgcggctgcggcagtgcgcccaacagc     60
       ............................................................
61     ggactccgagaccagcggatctcggcaaaccctctttctcgaccacccacctaccattct    120
       ............................................................
121    tggaaccATGGCGGCAGTGGCGGCGGCCTCGGCTGAACTGCTCATCATCGGCTGGTACAT    180
       .......M--A--A--V--A--A--A--S--A--E--L--L--I--I--G--W--Y--I-
181    CTTCCGCGTGCTGCTGCAGGTGTTCCTGGAATGCTGCATTTACTGGGTAGGATTCGCTTT    240
       -F--R--V--L--L--Q--V--F--L--E--C--C--I--Y--W--V--G--F--A--F-
241    TCGAAATCCTCCAGGGACACAGCCCATTGCGAGAAGTGAGGTGTTCAGGTACTCCCTGCA    300
       -R--N--P--P--G--T--Q--P--I--A--R--S--E--V--F--R--Y--S--L--Q-
301    GAAGCTGGCATACACGGTGTCGCGGACCGGGCGGCAGGTGTTGGGGGAGCGCAGGCAGCG    360
       -K--L--A--Y--T--V--S--R--T--G--R--Q--V--L--G--E--R--R--Q--R-
361    AGCCCCCAACTGAggccccagctcccagccctgggcggccgtatcatcaggtgctcctgt    420
       -A--P--N--***...............................................
421    gcatctcggccagcacgggagccagtgccgcgcaggaatgtggggtcccctgtgttccct    480
       ............................................................
481    cgccagaggagcacttggcaaggtcagtgaggggccagtagacccccggagaagcagtac    540
       ............................................................
541    cgacaatgacgaagataccagatcccttcccaacccctttgcaccggtcccactaagggg    600
       ............................................................
601    cagggtcgagagaggaggggggatagggggagcagacccctgagatctgggcataggcac    660
       ............................................................
661    cgcattctgatctggacaaagtcgggacagcaccatcccagccccgaagccagggccatg    720
       ............................................................
721    ccagcaggccccaccatggaaatcaaaacaccgcaccagccagcagaatggacattctga    780
       ............................................................
781    catcgccagccgacgccctgaatcttggtgcagcaccaaccgcgtgcctgtgtggcggga    840
       ............................................................
841    ctggagggcacagttgaggaaggagggtggttaagaaatacagtggggccctctcgctgt    900
       ............................................................
901    cccttgcccagggcacttgcattccagcctcgctgcatttgctctctcgattcccctttc    960
       ............................................................
961    ctcctcactgcctcccaagcccaccctactccaaaataatgtgtcacttgatttggaact   1020
       ............................................................
1021   attcaagcagtaaaagtaaatgaatcccacctttactaaaacactttctctgaacccccc   1080
       ............................................................
1081   ttgcccctcactgatcttgcttttccctggtctcatgcagttgtggtcaatattgtggta   1140
       ............................................................
1141   atcgctaattgtactgattgtttaagtgtgcattagttgtgtctccccagctagattgta   1200
       ............................................................
1201   agctcctggaggacagggaccacctctacaaaaaataaaaaaagtacctcccctgtctcg   1260
       ............................................................
1261   cacagtgtcccaggaccctgcggtgcagtagaggcgcaccaaaaaaaaaaaaaaaaaaaa   1320
       ............................................................
1321   aaaaaaaaaaaaaaaaaa                                             1380
       ..................