Imprinted Gene Databases

Homo sapiens: NLRP2

NLR family, pyrin domain containing 2

Bjornsson et al., Genome Res. 18: 771-779, 2008

Species Gene Aliases Location Status Expressed Allele
Homo sapiens NLRP2 NBS1, PAN1, NALP2, PYPAF2, CLR19.9  19q13.42  Imprinted Maternal
1      agtgctcagcaacgattacgccccgagggccaatcacagggctgcggccgagagagaagc     60
       ............................................................
61     cttattagagctttctcaacctgcagccctcatctccgccggcgagtagggccaggtgtt    120
       ............................................................
121    gggagctcccacgtgggacaagATGGTGTCTTCGGCGCAGATGGGCTTCAACCTGCAGGC    180
       ......................M--V--S--S--A--Q--M--G--F--N--L--Q--A-
181    TCTCCTGGAGCAGCTCAGCCAGGATGAGTTGAGCAAGTTCAAGTATCTGATCACGACCTT    240
       -L--L--E--Q--L--S--Q--D--E--L--S--K--F--K--Y--L--I--T--T--F-
241    CTCCCTGGCACACGAGCTCCAGAAGATCCCCCACAAGGAGGTAGACAAGGCTGATGGGAA    300
       -S--L--A--H--E--L--Q--K--I--P--H--K--E--V--D--K--A--D--G--K-
301    GCAACTGGTAGAAATCCTCACCACCCATTGTGACAGCTACTGGGTGGAGATGGCGAGCCT    360
       -Q--L--V--E--I--L--T--T--H--C--D--S--Y--W--V--E--M--A--S--L-
361    CCAGGTCTTTGAAAAGATGCACCGAATGGATCTGTCTGAGAGAGCAAAGGATGAAGTCAG    420
       -Q--V--F--E--K--M--H--R--M--D--L--S--E--R--A--K--D--E--V--R-
421    AGAAGCAGCTTTGAAATCCTTTAATAAAAGGAAGCCTCTATCATTAGGGATAACACGGAA    480
       -E--A--A--L--K--S--F--N--K--R--K--P--L--S--L--G--I--T--R--K-
481    AGAACGACCACCTCTAGACGTGGACGAAATGCTGGAGCGCTTCAAAACAGAAGCACAAGC    540
       -E--R--P--P--L--D--V--D--E--M--L--E--R--F--K--T--E--A--Q--A-
541    GTTTACAGAAACGAAAGGAAATGTCATCTGCCTGGGTAAAGAAGTCTTTAAAGGAAAAAA    600
       -F--T--E--T--K--G--N--V--I--C--L--G--K--E--V--F--K--G--K--K-
601    GCCAGACAAAGACAATAGGTGCAGGTATATATTGAAGACGAAGTTCCGGGAGATGTGGAA    660
       -P--D--K--D--N--R--C--R--Y--I--L--K--T--K--F--R--E--M--W--K-
661    GAGCTGGCCTGGAGATAGCAAAGAGGTCCAGGTTATGGCTGAGAGATACAAGATGCTGAT    720
       -S--W--P--G--D--S--K--E--V--Q--V--M--A--E--R--Y--K--M--L--I-
721    CCCATTCAGCAACCCCAGGGTGCTTCCCGGGCCCTTCTCATACACGGTGGTGCTGTATGG    780
       -P--F--S--N--P--R--V--L--P--G--P--F--S--Y--T--V--V--L--Y--G-
781    TCCTGCAGGCCTTGGGAAAACCACGCTGGCCCAGAAACTAATGCTAGACTGGGCAGAGGA    840
       -P--A--G--L--G--K--T--T--L--A--Q--K--L--M--L--D--W--A--E--D-
841    CAACCTCATCCACAAATTCAAATATGCGTTCTACCTCAGCTGCAGGGAGCTCAGCCGCCT    900
       -N--L--I--H--K--F--K--Y--A--F--Y--L--S--C--R--E--L--S--R--L-
901    GGGCCCGTGCAGTTTTGCAGAGCTGGTCTTCAGGGACTGGCCTGAATTGCAGGATGACAT    960
       -G--P--C--S--F--A--E--L--V--F--R--D--W--P--E--L--Q--D--D--I-
961    TCCACACATCCTAGCCCAAGCACGGAAAATCTTGTTCGTGATTGACGGCTTTGATGAGCT   1020
       -P--H--I--L--A--Q--A--R--K--I--L--F--V--I--D--G--F--D--E--L-
1021   GGGAGCCGCACCTGGGGCGCTGATCGAGGACATCTGCGGGGACTGGGAGAAGAAGAAGCC   1080
       -G--A--A--P--G--A--L--I--E--D--I--C--G--D--W--E--K--K--K--P-
1081   GGTGCCCGTCCTCCTGGGGAGTTTGCTGAACAGGGTGATGTTACCCAAGGCCGCCCTGCT   1140
       -V--P--V--L--L--G--S--L--L--N--R--V--M--L--P--K--A--A--L--L-
1141   GGTCACCACGCGGCCCAGGGCCCTGAGGGACCTCCGGATCCTGGCGGAGGAGCCGATCTA   1200
       -V--T--T--R--P--R--A--L--R--D--L--R--I--L--A--E--E--P--I--Y-
1201   CATAAGGGTGGAGGGCTTCCTGGAGGAGGACAGGAGGGCCTATTTCCTGAGACACTTTGG   1260
       -I--R--V--E--G--F--L--E--E--D--R--R--A--Y--F--L--R--H--F--G-
1261   AGACGAGGACCAAGCCATGCGTGCCTTTGAGCTAATGAGGAGCAACGCGGCCCTGTTCCA   1320
       -D--E--D--Q--A--M--R--A--F--E--L--M--R--S--N--A--A--L--F--Q-
1321   GCTGGGCTCGGCCCCCGCGGTGTGCTGGATCGTGTGCACGACTCTGAAGCTGCAGATGGA   1380
       -L--G--S--A--P--A--V--C--W--I--V--C--T--T--L--K--L--Q--M--E-
1381   GAAGGGGGAGGACCCGGTCCCCACCTGCCTCACCCGCACGGGGCTGTTCCTGCGTTTCCT   1440
       -K--G--E--D--P--V--P--T--C--L--T--R--T--G--L--F--L--R--F--L-
1441   CTGCAGCCGGTTCCCGCAGGGCGCACAGCTGCGGGGCGCGCTGCGGACGCTGAGCCTCCT   1500
       -C--S--R--F--P--Q--G--A--Q--L--R--G--A--L--R--T--L--S--L--L-
1501   GGCCGCGCAGGGCCTGTGGGCGCAGACGTCCGTGCTTCACCGAGAGGATCTGGAAAGGCT   1560
       -A--A--Q--G--L--W--A--Q--T--S--V--L--H--R--E--D--L--E--R--L-
1561   CGGGGTGCAGGAGTCCGACCTCCGTCTGTTCCTGGACGGAGACATCCTCCGCCAGGACAG   1620
       -G--V--Q--E--S--D--L--R--L--F--L--D--G--D--I--L--R--Q--D--R-
1621   AGTCTCCAAAGGCTGCTACTCCTTCATCCACCTCAGCTTCCAGCAGTTTCTCACTGCCCT   1680
       -V--S--K--G--C--Y--S--F--I--H--L--S--F--Q--Q--F--L--T--A--L-
1681   GTTCTACACCCTGGAGAAGGAGGAGGAAGAGGATAGGGACGGCCACACCTGGGACATTGG   1740
       -F--Y--T--L--E--K--E--E--E--E--D--R--D--G--H--T--W--D--I--G-
1741   GGACGTACAGAAGCTGCTTTCCGGAGTAGAAAGACTCAGGAACCCCGACCTGATCCAAGC   1800
       -D--V--Q--K--L--L--S--G--V--E--R--L--R--N--P--D--L--I--Q--A-
1801   AGGCTACTACTCCTTTGGCCTCGCTAACGAGAAGAGAGCCAAGGAGTTGGAGGCCACTTT   1860
       -G--Y--Y--S--F--G--L--A--N--E--K--R--A--K--E--L--E--A--T--F-
1861   TGGCTGCCGGATGTCACCGGACATCAAACAGGAATTGCTGCGATGCGACATAAGTTGTAA   1920
       -G--C--R--M--S--P--D--I--K--Q--E--L--L--R--C--D--I--S--C--K-
1921   GGGTGGACATTCAACGGTGACAGACCTGCAGGAGCTCCTCGGCTGTCTGTACGAGTCTCA   1980
       -G--G--H--S--T--V--T--D--L--Q--E--L--L--G--C--L--Y--E--S--Q-
1981   GGAGGAGGAGCTGGTGAAGGAGGTGATGGCTCAGTTCAAAGAAATATCCCTGCACTTAAA   2040
       -E--E--E--L--V--K--E--V--M--A--Q--F--K--E--I--S--L--H--L--N-
2041   TGCAGTAGACGTTGTGCCATCTTCATTCTGCGTCAAGCACTGTCGAAACCTGCAGAAAAT   2100
       -A--V--D--V--V--P--S--S--F--C--V--K--H--C--R--N--L--Q--K--M-
2101   GTCACTGCAGGTAATAAAGGAGAATCTCCCGGAGAATGTCACTGCGTCTGAATCAGACGC   2160
       -S--L--Q--V--I--K--E--N--L--P--E--N--V--T--A--S--E--S--D--A-
2161   CGAGGTTGAGAGATCCCAGGATGATCAGCACATGCTTCCTTTCTGGACGGACCTTTGTTC   2220
       -E--V--E--R--S--Q--D--D--Q--H--M--L--P--F--W--T--D--L--C--S-
2221   CATATTTGGATCAAATAAGGATCTGATGGGTCTAGCAATCAATGATAGCTTTCTCAGTGC   2280
       -I--F--G--S--N--K--D--L--M--G--L--A--I--N--D--S--F--L--S--A-
2281   CTCCCTAGTAAGGATCCTGTGTGAACAAATAGCCTCTGACACCTGTCATCTCCAGAGAGT   2340
       -S--L--V--R--I--L--C--E--Q--I--A--S--D--T--C--H--L--Q--R--V-
2341   GGTGTTCAAAAACATTTCCCCAGCTGATGCTCATCGGAACCTCTGCCTAGCTCTTCGAGG   2400
       -V--F--K--N--I--S--P--A--D--A--H--R--N--L--C--L--A--L--R--G-
2401   TCACAAGACTGTAACGTATCTGACCCTTCAAGGCAATGACCAGGATGATATGTTTCCCGC   2460
       -H--K--T--V--T--Y--L--T--L--Q--G--N--D--Q--D--D--M--F--P--A-
2461   ATTGTGTGAGGTCTTGAGACATCCAGAATGTAACCTGCGATATCTCGGGTTGGTGTCTTG   2520
       -L--C--E--V--L--R--H--P--E--C--N--L--R--Y--L--G--L--V--S--C-
2521   TTCCGCTACCACTCAGCAGTGGGCTGATCTCTCCTTGGCCCTTGAAGTCAACCAGTCCCT   2580
       -S--A--T--T--Q--Q--W--A--D--L--S--L--A--L--E--V--N--Q--S--L-
2581   GACGTGCGTAAACCTCTCCGACAATGAGCTTCTGGATGAGGGTGCTAAGTTGCTGTACAC   2640
       -T--C--V--N--L--S--D--N--E--L--L--D--E--G--A--K--L--L--Y--T-
2641   AACTTTGAGACACCCCAAGTGCTTTCTGCAGAGGTTGTCGTTGGAAAACTGTCACCTTAC   2700
       -T--L--R--H--P--K--C--F--L--Q--R--L--S--L--E--N--C--H--L--T-
2701   AGAAGCCAATTGCAAGGACCTTGCTGCTGTGTTGGTTGTCAGCCGGGAGCTGACACACCT   2760
       -E--A--N--C--K--D--L--A--A--V--L--V--V--S--R--E--L--T--H--L-
2761   GTGCTTGGCCAAGAACCCCATTGGGAATACAGGGGTGAAGTTTCTGTGTGAGGGCTTGAG   2820
       -C--L--A--K--N--P--I--G--N--T--G--V--K--F--L--C--E--G--L--R-
2821   GTACCCCGAGTGTAAACTGCAGACCTTGGTGCTTTGGAACTGCGACATAACTAGCGATGG   2880
       -Y--P--E--C--K--L--Q--T--L--V--L--W--N--C--D--I--T--S--D--G-
2881   CTGCTGCGATCTCACAAAGCTTCTCCAAGAAAAATCAAGCCTGTTGTGTTTGGATCTGGG   2940
       -C--C--D--L--T--K--L--L--Q--E--K--S--S--L--L--C--L--D--L--G-
2941   GCTGAATCACATAGGAGTTAAGGGAATGAAGTTCCTGTGTGAGGCTTTGAGGAAACCACT   3000
       -L--N--H--I--G--V--K--G--M--K--F--L--C--E--A--L--R--K--P--L-
3001   GTGCAACTTGAGATGTCTGTGGTTGTGGGGATGTTCCATCCCTCCGTTCAGTTGTGAAGA   3060
       -C--N--L--R--C--L--W--L--W--G--C--S--I--P--P--F--S--C--E--D-
3061   CCTCTGCTCTGCCCTCAGCTGCAACCAGAGCCTCGTCACTCTGGACCTGGGTCAGAATCC   3120
       -L--C--S--A--L--S--C--N--Q--S--L--V--T--L--D--L--G--Q--N--P-
3121   CTTGGGGTCTAGTGGAGTGAAGATGCTGTTTGAAACCTTGACATGTTCCAGTGGCACCCT   3180
       -L--G--S--S--G--V--K--M--L--F--E--T--L--T--C--S--S--G--T--L-
3181   CCGGACACTCAGGTTGAAAATCGATGACTTTAATGATGAACTCAATAAGCTGCTGGAAGA   3240
       -R--T--L--R--L--K--I--D--D--F--N--D--E--L--N--K--L--L--E--E-
3241   AATAGAAGAAAAAAACCCACAACTGATTATTGATACTGAGAAACATCATCCCTGGGCAGA   3300
       -I--E--E--K--N--P--Q--L--I--I--D--T--E--K--H--H--P--W--A--E-
3301   AAGGCCTTCTTCTCATGACTTCATGATCTGAatccccccgagtcattcattctccatgaa   3360
       -R--P--S--S--H--D--F--M--I--***.............................
3361   gtcatcgattttccaggtgttggtgaactgcctgtgactcctctcctccccggcccctac   3420
       ............................................................
3421   ccctcagggataatgagttcattgctgggctagatgttttagccatgattctgcctctgt   3480
       ............................................................
3481   tttatacctgcacacatccttatctttgttacatatgaaatatctgtatcacgggtatat   3540
       ............................................................
3541   tgagagaaataaaggtgagagcattcacaaatgaaaaaaaaaaaaaaaaa             3600
       ..................................................