Imprinted Gene Databases

Homo sapiens: NDN

Necdin homolog
Species Gene Aliases Location Status Expressed Allele
Homo sapiens NDN HsT16328  15q11.2-q12  Imprinted Paternal
Mus musculus Ndn Peg6, AI528698  7 28.0 cM  Imprinted Paternal
Macaca mulatta NDN   Imprinted Paternal
Sus scrofa NECD NDN  Imprinted Paternal
1      acttcctctccaggaatccgcggagggagcgcaggctcgaagagctcctggacgcagagg     60
       ............................................................
61     ccctgcccttgccagacggcgcagacATGTCAGAACAAAGTAAGGATCTGAGCGACCCTA    120
       ..........................M--S--E--Q--S--K--D--L--S--D--P--N
121    ACTTTGCAGCCGAGGCCCCCAACTCCGAGGTGCACAGCAGCCCTGGGGTTTCGGAGGGGG    180
       --F--A--A--E--A--P--N--S--E--V--H--S--S--P--G--V--S--E--G--V
181    TTCCTCCGTCCGCGACCCTGGCAGAGCCGCAGAGCCCTCCTCTAGGCCCGACGGCCGCTC    240
       --P--P--S--A--T--L--A--E--P--Q--S--P--P--L--G--P--T--A--A--P
241    CGCAGGCCGCGCCGCCTCCCCAGGCCCCGAACGACGAGGGCGACCCGAAGGCCCTGCAGC    300
       --Q--A--A--P--P--P--Q--A--P--N--D--E--G--D--P--K--A--L--Q--Q
301    AGGCTGCGGAGGAGGGCCGCGCCCACCAGGCCCCGAGCGCGGCCCAGCCGGGCCCGGCAC    360
       --A--A--E--E--G--R--A--H--Q--A--P--S--A--A--Q--P--G--P--A--P
361    CGCCAGCCCCGGCGCAGCTGGTGCAGAAGGCGCACGAGCTCATGTGGTACGTGCTGGTCA    420
       --P--A--P--A--Q--L--V--Q--K--A--H--E--L--M--W--Y--V--L--V--K
421    AGGACCAGAAGAAGATGATCATCTGGTTTCCAGACATGGTGAAAGATGTCATCGGCAGCT    480
       --D--Q--K--K--M--I--I--W--F--P--D--M--V--K--D--V--I--G--S--Y
481    ACAAGAAGTGGTGCAGGAGCATCCTCCGGCGCACCAGCCTCATCCTCGCCCGGGTGTTCG    540
       --K--K--W--C--R--S--I--L--R--R--T--S--L--I--L--A--R--V--F--G
541    GGCTGCACCTGAGGCTAACCAGCCTGCACACCATGGAGTTTGCGCTGGTCAAAGCGCTGG    600
       --L--H--L--R--L--T--S--L--H--T--M--E--F--A--L--V--K--A--L--E
601    AGCCCGAGGAGCTGGACAGGGTGGCGCTGAGCAACCGCATGCCCATGACAGGCCTCCTGC    660
       --P--E--E--L--D--R--V--A--L--S--N--R--M--P--M--T--G--L--L--L
661    TCATGATCCTGAGCCTCATCTACGTGAAGGGCCGCGGCGCCAGAGAGAGCGCCGTCTGGA    720
       --M--I--L--S--L--I--Y--V--K--G--R--G--A--R--E--S--A--V--W--N
721    ACGTGCTGCGCATCCTGGGGCTGCGGCCCTGGAAGAAGCACTCCACCTTCGGGGACGTGC    780
       --V--L--R--I--L--G--L--R--P--W--K--K--H--S--T--F--G--D--V--R
781    GGAAGCTCATCACTGAGGAGTTCGTCCAAATGAATTACCTGAAGTACCAGCGCGTCCCAT    840
       --K--L--I--T--E--E--F--V--Q--M--N--Y--L--K--Y--Q--R--V--P--Y
841    ACGTGGAGCCGCCCGAATACGAGTTCTTTTGGGGCTCCCGGGCCAGCCGCGAAATCACCA    900
       --V--E--P--P--E--Y--E--F--F--W--G--S--R--A--S--R--E--I--T--K
901    AGATGCAAATCATGGAGTTCCTGGCCAGGGTCTTTAAGAAAGACCCCCAGGCCTGGCCCT    960
       --M--Q--I--M--E--F--L--A--R--V--F--K--K--D--P--Q--A--W--P--S
961    CCCGATACAGAGAAGCTCTGGAGGAGGCCAGAGCTCTGCGGGAGGCTAATCCCACTGCCC   1020
       --R--Y--R--E--A--L--E--E--A--R--A--L--R--E--A--N--P--T--A--H
1021   ACTACCCTCGCAGCAGTGTCTCTGAGGACTAGcaaagtctggaggcagatgaatggtttc   1080
       --Y--P--R--S--S--V--S--E--D--***............................
1081   tgaccctcaccagggctgtggaagggtgggggtgggtcattatagtattcaggatttaca   1140
       ............................................................
1141   gtgcagtattcacgtgtaacttttaagttttcagtacagtgcttttatacctttaatgca   1200
       ............................................................
1201   atgttgtattcatttgggtactattgtgtagtatttaggatgtatgcatgtttgtttata   1260
       ............................................................
1261   tgtaagcttggttggtgctttcgcttttgtgctacctttcttggatttttgtaccagaga   1320
       ............................................................
1321   tgtgctaaactgatgaaatacattgagaaagtttccatcttattcttttatatgggactg   1380
       ............................................................
1381   atgatgtgtgttggggtagactgctcctgcagagtttggaagaagtcaccagcaaagccg   1440
       ............................................................
1441   gcctaaccaagaaaagtcaaggcccttcatgaccttgctgggcacagaaaacaccctcgt   1500
       ............................................................
1501   ggagtacactaatttgaactggactggtctcagtgtgagcacttggcacactttactaaa   1560
       ............................................................
1561   cacatatacaaccccaccgtgagtcaactttaaagtaaacattaaagattcttgtgatac   1620
       ............................................................
1621   aatcatttttggaaaagtgtactttatcattttaacaaagcagtatggttgggaatgaga   1680
       ............................................................
1681   caattctctattttacagtgtatacagatacaactatttcccctaatagggtgggaaaaa   1740
       ............................................................
1741   tcgctactcatgattactcctaaatttgtgaagtttatagttctattgtctttaaatgta   1800
       ............................................................
1801   actcatgtttatttcaaaaacattcacaaatatagaaaagtatacaaaacaaaacagtaa   1860
       ............................................................
1861   gattgtctgtaatcacatcatatgggaataaaaaaca                          1920
       .....................................