Imprinted Gene Databases

Homo sapiens: NAP1L5

Nucleosome assembly protein 1-like 5
Species Gene Aliases Location Status Expressed Allele
Sus scrofa NAP1L5   Imprinted Paternal
Homo sapiens NAP1L5 DRLM  4q22.1  Imprinted Paternal
Mus musculus Nap1l5 1110020M21Rik  6 C1  Imprinted Paternal
Bos taurus NAP1L5   Imprinted Paternal
1      gtcattcccgcggccgcacgtcaccgccacttgccgcatccgcaagatctctctggacca     60
       ............................................................
61     gctcgggtgcagggcctctgcgggagccctcctagacctctgcggcttctcctctaacAT    120
       ..........................................................M-
121    GGCCGACTCGGAAAACCAGGGGCCTGCGGAGCCTAGCCAGGCGGCGGCAGCGGCGGAGGC    180
       -A--D--S--E--N--Q--G--P--A--E--P--S--Q--A--A--A--A--A--E--A-
181    AGCGGCAGAGGAGGTAATGGCGGAAGGCGGTGCGCAGGGTGGAGACTGTGACAGCGCGGC    240
       -A--A--E--E--V--M--A--E--G--G--A--Q--G--G--D--C--D--S--A--A-
241    TGGTGACCCTGACAGCGCGGCTGGTCAGATGGCTGAGGAGCCCCAGACCCCTGCAGAGAA    300
       -G--D--P--D--S--A--A--G--Q--M--A--E--E--P--Q--T--P--A--E--N-
301    TGCCCCAAAGCCGAAAAATGACTTTATCGAGAGCCTGCCTAATTCGGTGAAATGCCGAGT    360
       -A--P--K--P--K--N--D--F--I--E--S--L--P--N--S--V--K--C--R--V-
361    CCTGGCCCTCAAAAAGCTGCAGAAGCGATGCGATAAGATAGAAGCCAAATTTGATAAGGA    420
       -L--A--L--K--K--L--Q--K--R--C--D--K--I--E--A--K--F--D--K--E-
421    ATTTCAGGCTCTGGAAAAAAAGTATAATGACATCTATAAGCCCCTACTCGCCAAGATCCA    480
       -F--Q--A--L--E--K--K--Y--N--D--I--Y--K--P--L--L--A--K--I--Q-
481    AGAGCTCACCGGCGAGATGGAGGGGTGTGCATGGACCTTGGAGGGGGAGGAGGAGGAGGA    540
       -E--L--T--G--E--M--E--G--C--A--W--T--L--E--G--E--E--E--E--E-
541    AGAGGAGTACGAGGATGACGAGGAGGAGGGGGAAGACGAGGAGGAGGAGGAGGCTGCGGC    600
       -E--E--Y--E--D--D--E--E--E--G--E--D--E--E--E--E--E--A--A--A-
601    AGAGGCTGCCGCGGGGGCCAAACATGACGATGCCCACGCCGAGATGCCTGATGACGCCAA    660
       -E--A--A--A--G--A--K--H--D--D--A--H--A--E--M--P--D--D--A--K-
661    GAAGTAAggggggcagagatggatgaagagaaagcccacgaagaaaaaagcctggttttg    720
       -K--***.....................................................
721    tttttcccagaatatcgatggacttaaaaaggctcaggtttttgaccaaaatacaatgtg    780
       ............................................................
781    aatttattctgacattcctaaaatagattaaattaaagcaattagatcctggccagctcg    840
       ............................................................
841    attcaaatttgactttcattttgaacataataaatatatcaaaaggtgttaaagaaaact    900
       ............................................................
901    gaattaaacccaaaattatgttttcatggtctcttctctgaggattgaggtttacaaagg    960
       ............................................................
961    gtgttagcagatgcgaagtaaagaacgtcactttgaaacccattcatcacacagcatacg   1020
       ............................................................
1021   ctacacatggaacacccaagccatgactgaacacgttctcagtgcttaattcttaaattt   1080
       ............................................................
1081   ctttactcatgacatttcgcagtgcagagaaggcagaacccaagaaaaacgtcatctttg   1140
       ............................................................
1141   agactttgcttttgtaacgcagacatcagctttacacttcacaggagattgatggcattg   1200
       ............................................................
1201   aggaagattgcaatggagatcatgacactactgttaataaggccaggaaaactgccattt   1260
       ............................................................
1261   caagttctgaaaaatgttttgagtatttgaatttagagaaacaacatggttccaagaagg   1320
       ............................................................
1321   agggtgtaaaacctgtaaaatactgtcaacatatgtattcattagttacaatctcatgtt   1380
       ............................................................
1381   tgtgttttcttagtactgtctatttacaaacacgtaaaaaataccccaaatatgtttaag   1440
       ............................................................
1441   tattaaatcactttacctagcgttttagaaatattaatttacttgaagagatgtagaatg   1500
       ............................................................
1501   tagcaaattatgtaaagcatgtgtatccagcgttatgtactttgcgccttgtgacgtctt   1560
       ............................................................
1561   tctgtcatgtagcttttagggtgtagctgtgaaaatcatcagaactcttcactgaagcta   1620
       ............................................................
1621   atgtttggaaaaaatatatacttgaagaaccaatccaagtgtgtgcccctacccccagct   1680
       ............................................................
1681   cagaagtagaaagggtttaagtttgcttgtattagctgtgccttcattattttgctatgt   1740
       ............................................................
1741   aaatgtgacatattaattataaaatggtgcataatcaaattttactgcttgaggacagat   1800
       ............................................................
1801   gcatacagtaaggatttttaggaagaatatatttaatgtaaagactcttagcttctgtgt   1860
       ............................................................
1861   gggttttgaattatgtgtgagccagtgatctataaagaaacataagcttaaagttgttta   1920
       ............................................................
1921   tcactgtggtgttaataaaacagtattttcaaaaaataaaaaaaa                  1980
       .............................................